Exeley Inc.

Reid, Marion E.

MNS blood group system: a review

Gulliksson, Hans

Platelet additive solutions: current status

Huber, Aaron R.

Leonard, George T.

Driggers, Rita W.

Learn, Sakhone B.

Gilstad, Colleen W.

Case report:moderate hemolytic disease of the newborn due to anti-G

Cho, Duck

Lee, Jin Sol

Yazer, Mark Harris

Song, Jong Won

Shin, Myung Geun

Shin, Jong Hee

Suh, Soon Pal

Jeon, Mee Jeong

Kim, Ji Young

Park, Jong Tae

Ryang, Dong Wook

Chimerism and mosaicism are important causes of ABO phenotype and genotype discrepancies

Leger, Regina M.

Garratty, George

I M M U N O H E M A T O L O G Y, V O L U M E 2 2 , N U M B E R 4 , 2 0 0 6 205
C O M M U N I C A T I O N S C O N T ’ D
Letter to the Editors
A reminder that ZZAP reagent removes complement in addition to IgG from coated RBCs
A case was submitted to our laboratory for serologic classification of an autoimmune hemolytic anemia
(AIHA). The patient’s RBCs were spontaneously agglutinated (i.e., the 6% albumin control was reactive) after
washing with room temperature and 37°C saline in preparation for the DAT. Thus, the RBCs needed to be treated
with a sulfhydryl reagent (DTT or 2-ME) to disperse the IgM-mediated autoagglutination.1 The patient's DTT-
treated RBCs reacted strongly with anti-C3 and did not react with anti-IgG and a 6% albumin control; they reacted
microscopically with anti-IgM. The patient’s plasma strongly agglutinated (4+, titer = 4) adult group O RBCs at
37°C (prewarmed), but did not agglutinate cord or DTT-treated autologous RBCs. At 30°C, 18°C, and 4°C, the titer
was 16, 128, and 128 with adult RBCs and 4, 32, and 64 with cord RBCs, respectively. The titer with autologous
RBCs was consistently one tube less than that obtained with cord RBCs. In our AIHA serum screen,2 the DTT-
treated autologous RBCs incubated at 37°C with the patient’s serum did not react while autologous RBCs
incubated at 18°C or DTT-treated autologous RBCs that were subsequently enzyme-treated were strongly
agglutinated. Additional testing confirmed that the 37°C reactive agglutinin was IgM autoanti-I,not an alloantibody
to an antigen not expressed or weakly expressed on cord RBCs. In this patient with hemolytic anemia, the serology
was consistent with cold agglutinin syndrome (CAS) associated with moderate titer, high thermal amplitude
antibodies.
As Dacie noted in 1962, cold agglutinin titers in patients with CAS are often lower with autologous RBCs than
with allogeneic RBCs.3 This appears to be due to steric hindrance by complement (mainly C3dg) accumulated on
the RBCs following exposure to anti-I.4 Typically, for our serologic classification of CAS, autologous RBCs after
washing with 37°C saline give an accurate DAT result; i.e., the cold agglutinin is eluted from the RBCs and the 6%
albumin control does not react. On occasion,as was noted in this case, the albumin control is still reactive washing
with 37°C saline and sulfhydryl treatment is used to disperse the spontaneous agglutination. When 37°C washing
or sulfhydryl treatment is required for the DAT, that same preparation of the patient’s RBCs is used for other tests
requiring autologous RBCs, e.g., titration studies.
Removing immunoglobulin from coated RBCs with ZZAP (DTT plus enzyme) is an alternative method to
sulfhydryl reagents alone for obtaining unagglutinated RBCs suitable for testing other than the DAT. ZZAP was
originally reported as an effective reagent for dissociating IgG from RBCs of patients with warm AIHA5 but
immunohematologists often forget that the reagent also removes IgM and complement from coated RBCs.6
Sulfhydryl reagents when used alone dissociate pentameric IgM through cleavage of disulfide bonds connecting
the monomeric subunits but do not remove immunoglobulin or complement.
To check our suspicions that the large amount of complement coating the autologous RBCs was blocking
agglutination by the anti-I at 37°C, we treated the autologous RBCs with ZZAP reagent and retested with the
patient’s plasma at 37°C. The ZZAP-treated autologous RBCs were strongly agglutinated (3+) whereas the DTT-
treated RBCs were not agglutinated. When tested with anti-C3, the ZZAP-treated autologous RBCs demonstrated a
decrease of reactivity to w+ compared with 3+ reactivity with the DTT-treated autologous RBCs tested in parallel.
The results of testing of RBCs from four other patients with either warm or cold serum autoantibodies or both
confirmed abolished or decreased reactivity with anti-C3 and anti-IgG after the RBCs were treated with ZZAP.
In this case, the pattern of reactivity of the agglutinin in the initial titer and thermal amplitude studies had the
appearance of an alloantibody at 37°C. DTT treatment alone appeared to have disassociated the IgM molecules
that caused the spontaneous agglutination detected in the DAT but left C3 and at least some IgM monomers on
the autologous RBCs. ZZAP treatment of the RBCs confirmed the autoantibody reactivity at 37°C, presumably
because of the removal of C3 from the RBCs and enzyme enhancement of the anti-I reactivity. Enzyme treatment
206 I M M U N O H E M A T O L O G Y, V O L U M E 2 2 , N U M B E R 4 , 2 0 0 6
C O M M U N I C A T I O N S C O N T ’ D
alone would not have enabled testing of the autologous RBCs as enzymes do not abolish spontaneous
agglutination.
References
1. Reid ME.Autoagglutination dispersal utilizing sulfhydryl compounds.Transfusion 1978;18:353-5.
2. Petz LD, Garratty G. Immune hemolytic anemias. 2nd ed. Philadelphia: Churchill Livingstone, 2004.
3. Dacie JV.The haemolytic anemias:congenital and acquired.Part II:The autoimmune haemolytic anemias.New
York: Grune & Stratton, Inc., 1962: 468.
4. Evans RS, Turner E, Bingham M. Chronic hemolytic anemia due to cold agglutinins: The mechanism of
resistance of red cells to C' hemolysis by cold agglutinins. J Clin Invest 1967;46:1461-74.
5. Branch DR, Petz LD. A new reagent (ZZAP) having multiple applications in immunohematology. Am J Clin
Pathol 1982;78:161-7.
6. Branch DR. Blood transfusion in autoimmune hemolytic anemias. Lab Med 1984;15:402-8.
Regina M. Leger, MSQA,MT(ASCP)SBB
American Red Cross Blood Services
Southern California Region
Pomona, CA
George Garratty, PhD, FRCPath
American Red Cross Blood Services
Southern California Region
Pomona, CA
Notice to Readers: All articles published,
including communications and book reviews,
reflect the opinions of the authors and do not
necessarily reflect the official policy of the
American Red Cross.


A reminder that ZZAP reagent removes complement in addition to IgG from coated RBCs

Yan, Lixing

Zhu, Faming

Fu, Qihua

He, Ji

10 I M M U N O H E M A T O L O G Y, V O L U M E  2 1 , N U M B E R  1 , 2 0 0 5
The frequencies of selected alleles in the ABO,Rh,MNS,Duffy,Kidd,
Yt, Scianna, and Colton blood group systems were determined
among four indigenous Chinese ethnic populations: Han,Tajik, She,
and Yugu. Genotypes were determined by PCR or PCR with
sequence specific primers (PCR-SSP). In the Han population, the
frequencies of A1, A2, B, and O1 alleles were 0.189, 0.003, 0.170, and
0.638, respectively, and the O2 allele was not identified. Among D+
Hans, the frequencies of C and c alleles were 0.67 and 0.33 and the
frequencies of E and e were 0.22 and 0.78, respectively. Among D–
Hans, the frequencies of C and c alleles were 0.23 and 0.77 and the
frequencies of E and e were 0.04 and 0.96, respectively. The
frequencies of M and N alleles were 0.478 and 0.522 among Hans
and 0.655 and 0.345 among Tajiks, respectively. The frequencies of
Fya and Fyb alleles were 0.94 and 0.06 among Hans and 0.98 and
0.02 among Shes, respectively. The frequencies of Jka and Jkb alleles
were 0.49 and 0.51 among Hans and 0.56 and 0.44 among Shes,
respectively. The frequency of the Yta allele was 1.00 among Hans.
The frequencies of Yta and Ytb alleles were 0.94 and 0.06 among
Tajiks, respectively. The frequency of the Sc1 allele was 1.00 in both
Han and Tajik ethnic populations. The frequency of the Coa allele
was 1.00 in Han, She, and Tajik ethnic populations.
Immunohematology 2005;21:10–14.
Key Words: ABO, Rh, MNS, Duffy, Kidd, Yt, Scianna,
Colton, PCR-SSP, gene frequencies
Serologic studies of blood group gene frequencies
have established certain characteristics among
indigenous Asian (Mongoloid) populations when
compared to European (Caucasoid) populations.1 In
general,Asians have more B, M, and Fya alleles, fewer S
and P1. Lack of D is rare in Asians; the most common
Rh haplotypes are dCe and Dce. The availability of PCR
and polymerase chain reaction with sequence specific
primers (PCR-SSP) for detecting blood group alleles
provides a means for more precise characterization of
the genetic composition of different populations. We
describe the results of a pilot study for determining
selected alleles in the ABO, Rh, MNS, Duffy, Kidd, Yt,
Scianna, and Colton blood group systems among four
ethnic Chinese populations.
Materials and Methods
Blood samples
Peripheral blood samples were collected from
healthy volunteer blood donors after obtaining
informed consent. Based on information from personal
interviews, subjects were categorized by ethnic group
as Han (Zhejiang Province), She (Zhejiang Province),
Yugu (Gansu Province), or Tajik (Xijiang Province).
DNA extraction and genotyping 
Genomic DNA was extracted from whole-blood
samples, using a standard salting-out method. Blood
group genotypes were determined by PCR or PCR-SSP,
using previously described protocols, e.g., ABO,2
RHCE,3,4 GYPA,5 FY,6 SLC14A1(JK),7 ACHE,8 ERMAP,9
and AQP1.10 (Table 1).
Gene frequencies
Gene frequencies were calculated using the Hardy-
Weinberg equation, as modified by Mourant.1
Review of Chinese-language publications
We reviewed and summarized the results of other
studies of ABO blood group genotypes that had been
published in Chinese-language journals. The articles
were selected from journals that were listed in the
Qinghua computerized database for the years 1994 to
2004.
Results
Table 2 summarizes the results of genotyping and
gene frequencies, categorized by Rh, MNS, Duffy, Kidd,
Yt, Scianna, and Colton blood group systems. Han
samples were genotyped for selected genes in the Rh,
MNS, Duffy, Kidd,Yt, Scianna, and Colton blood group
systems and for A1, A2, B, O1, and O2. (Table 3)  We found
ABO, Rh, MNS, Duffy, Kidd,Yt,
Scianna, and Colton blood group
systems in indigenous Chinese
L.YAN, F. ZHU, Q. FU,AND J. HE
I M M U N O H E M A T O L O G Y, V O L U M E  2 1 , N U M B E R  1 , 2 0 0 5 11
Blood group systems in indigenous Chinese
Table 1. Amplification primers
Amplicon Method 
Locus Sense (5´⇒3´) Antisense (5´⇒3´) size(bp) and reference
ABO O1 tTaaGTGGAAGGATGTCCTCGTcGTA aTaTatATGCAAACACAGTTAACCCAATG 137
non O1 TaaGTGGAAGGATGTCCTCGTcGTG aTaTatATGCAAACACAGTTAACCCAATG 137 PCR-SSP
O2 tCGACCCCCCGAAGAAgCT aGTGGACGTGGACATGGAGTTCC 194
non O2 CGACCCCCCGAAGAAgCC aGTGGACGTGGACATGGAGTTCC 193 Gassner C et al.2
B atCGACCCCCCGAAGAgCG aGTGGACGTGGACATGGAGTTCC 195
non B CCGACCCCCCGAAGAgCC aGTGGACGTGGACATGGAGTTCC 194
A2 GAGGCGGTCCGGAA gCG ggGTGTGATTTGAGGTGGGGAC 169
non A2 gAGGCGGTCCGGAACaCG ggGTGTGATTTGAGGTGGGGAC 170
Rh RhC CAGGGCCACCACCATTTGAA GAACATGCCACT TCACTCCAG 357 PCR
Rhc TCGGCCAAG ATCTGACCG TGATGACCACCT TCCCAGG 177 Avent ND3
RHE CCAAGTGTCAACTCTC CATGCTGATCTTCCT 141 PCR-SSP
Rhe CCAAGTGTCAACTCTG CATGCTGATCTTCCT 141 Faas BHW et al.4
MN M CAGCATCAAGTACCACTGGT TGA AACTTC ATG AG CTC TAG 844 PCR-SSP
N CAGCATTAAGTACCACTGAG TGA AACTTCATG AG CTC TAG 844 Eshleman JR et al.5
Duffy Fya CTTCCCAGATGGAGACTATGA CATGAAGAGGACAGTGCTGCTAG 142 PCR-SSP
Fyb CTTCCCAGATGGAGACTATGG CATGAAGAGGACAGTGCTGCTAG 142 Olsson ML et al.6
Kidd Jka CCAGAGTCCAAAGTAGATGTC CATGCTGCCATAGGATCATTGC 301 PCR-SSP
Jkb CCAGAGTCCAAAGTAGATGTT CATGCTGCCATAGGATCATTGC 301 Irshaid NM et al.7
Yt Yta CATCAACGCGGGAGACTTCC TAGACCCATGGTGGCTTTGCT 214 PCR-SSP
Ytb CATCAACGCGGGAGACTTCA TAGACCCATGGTGGCTTTGCT 214 Mengli L et al.8
Sc Sc1 TCACCTCCTTGGGTACCGTACC CTCCCAGTTGGCCTTGTCTC 138 PCR-SSP
Sc2 TCACCTCCTTGGGTACCGTACT CTCCCAGTTGGCCTTGTCTC 138 Wagner FF et al.9
Co Coa ACATCTTCACGTTGTCCTGGAACG CAAGAAGAAGCTCTTCTGGAGG 143 PCR-SSP
Cob ACATCTTCACGTTGTCCTGGAACA CAAGAAGAAGCTCTTCTGGAGG 143 Joshi SR et al.10
Table 2. Genotypes and gene frequencies for Rh, MN, Duffy, Kidd,Yt, Scianna, and Colton blood group systems
Blood systems Population Number Genotype Gene frequency
Rh CC Cc cc C c
Han D+ 121 53 57 11 0.67 0.33
Han D– 111 7 38 66 0.23 0.77
Rh EE Ee ee E e
Han D+ 121 7 40 74 0.22 0.78
Han D– 110 0 9 101 0.04 0.96
MN MM MN NN M N
Han 115 25 60 30 0.478 0.522
Tajik 100 42 47 11 0.655 0.345
Duffy Fya/Fya Fya/Fyb Fyb/Fyb Fya Fyb
Han 102 91 10 1 0.94 0.06
She 90 87 3 0 0.98 0.02
Kidd Jka/Jka Jka/Jkb Jkb/Jkb Jka Jkb
Han 102 26 48 28 0.49 0.51
She 90 26 48 16 0.56 0.44
Yt Yta/Yta Yta/Ytb Ytb/Ytb Yta Ytb
Han 105 105 0 0 1.00 0
Tajik 100 89 10 1 0.94 0.06
Scianna Sc1/Sc1 Sc1/Sc2 Sc2/Sc2 Sc1 Sc2
Han 240 240 0 0 1.00 0
Tajik 100 100 0 0 1.00 0
Colton Coa/Coa Coa/Cob Cob/Cob Coa Cob
Han 103 103 0 0 1.00 0
She 62 62 0 0 1.00 0
Yugu 102 102 0 0 1.00 0
12 I M M U N O H E M A T O L O G Y, V O L U M E  2 1 , N U M B E R  1 , 2 0 0 5
L.YAN ET AL.
no O2 among the 156 Han samples tested. To compare
these data with those for other populations, results for
A1 and A2 were combined, yielding a gene frequency of
0.192 for the 156 Han samples. Tajik samples were
selectively genotyped for genes in the Yt, MNS, and
Scianna blood group systems. She samples were
genotyped for genes in the Duffy, Kidd, and Colton
blood group systems, and Yugu samples were
genotyped for genes in the Colton blood group system.
ABO
Of the 156 Han subjects whose samples were
genotyped for ABO, 4 (2.6%), 1 (0.6%), and 36 (23.1%)
were A1A1, A1A2, and A1O1, respectively; 14 (8.9%) were
A1B; 3 (1.9%) were BB; 33 (21.2%) were BO1; and
65(41.7%) were O1O1. The gene frequencies of A1, A2,
B, and O1 alleles were 0.189, 0.003, 0.170, and 0.638,
respectively.
Rh 
Of the 121 D+ Hans, 53 (43.8%) genotyped as CC,
57 (47.1%) typed as Cc, and 11 (9.1%) typed as cc. Of
the 111 D– Hans, 7 (6.3%) were genotyped as CC, 38
(34.2%) were Cc, and 66 (59.5%) were cc. The gene
frequencies of C and c alleles among D+ Hans were
0.67 and 0.33, respectively. Among D– Hans, the
frequencies of C and c alleles were 0.23 and 0.77,
respectively. Of the 121 D+ Hans, 7 (5.8%) were
genotyped as EE, 40 (33.0%) as Ee, and 74 (61.2%) as
ee. Among the 110 D– Hans, 9 (8.2%) were genotyped
as Ee and 101(91.8%) as ee. We did not detect the EE
genotype in this population. The gene frequencies of E
and e alleles in D+ Hans were 0.22 and 0.78; the
frequencies in D– Hans were 0.04 and 0.96,
respectively. The differences in RHCE allele
frequencies were significant between the D+ and D–
Hans.
MNS
We typed for MN alleles, but not Ss
alleles. Of the 115 Hans, 25 (21.7%) were
MM, 60 (52.2%) were MN, and 30 (26.1%)
were NN. The gene frequencies of M and N
alleles were 0.478 and 0.522, respectively.
Among 100 Tajiks, 42 (42%) were genotyped
as MM, 47 (47%) as MN, and 11 (11%) as NN.
The gene frequencies of M and N alleles were
0.655 and 0.345, respectively.
Duffy
Of the 102 Hans, 91 (89.2%) were
genotyped as Fya/Fya, 10 (9.8%) were typed as Fya/Fyb,
and 1(0.98%) was typed as Fyb/Fyb. Of the 90 Shes, 87
(96.7%) were Fya/Fya and 3 (3.3%) were Fya/Fyb. No
Shes typed as Fyb/Fyb and we did not find Fy/Fy in this
population. Among Hans, the gene frequencies of Fya
and Fyb alleles were 0.94 and 0.06, respectively. Among
Shes, the gene frequencies of Fya and Fyb alleles were
0.98 and 0.02, respectively.
Kidd
Of the 102 Hans, 26 (25.5%) were genotyped as
Jka/Jka, 48 (47.0%) were Jka/Jkb, and 28 (27.5%) were
Jkb/Jkb. Of the 90 Shes, 26 (28.9%) were Jka/Jka; 48
(53.3%) were Jka/Jkb, and 16 (17.8%) were Jkb/Jkb. We
did not find the Jk(a–b–) phenotype in this population.
Among Hans, the gene frequencies of Jka and Jkb alleles
were 0.49 and 0.51, respectively. Among Shes, the gene
frequencies of Jka and Jkb were 0.56 and 0.44,
respectively.
Yt
Among the 105 Hans, we found only Yta/Yta and,
thus, the frequency of Yta was 1.00. Among the 100
Tajiks, 89 (89%) were typed as Yta/Yta, 10 (10%) were
typed as Yta/Ytb, and 1 (1%) was typed as Ytb/Ytb. We
did not find the Yt(a–b–) phenotype in either the Han
or the Tajik population. Among Tajiks, the gene
frequencies of Yta and Ytb alleles were 0.94 and 0.06,
respectively.
Scianna
We typed for Sc1 and Sc2 alleles,but not for Rd and
Sc3. Among 240 Hans and 100 Tajiks all were Sc1/Sc1.
Therefore the frequency of Sc1 was 1.00 in both the
Han and Tajik populations.
Table 3. ABO gene frequencies in present and previously published studies of Chinese
Han populations
Han population Number A B O1 O2 Method
Zhejiang (present study) 156 0.192 0.170 0.638 0.00 PCR-SSP
Anfei11 240 0.229 0.213 0.568 nt PCR-SSP
Wuhan12 125 0.244 0.176 0.580 nt PCR-RFLP
Xuzhou13 104 0.249 0.245 0.504 0.00 PCR-SSP
Shanghai14 60 0.233 0.242 0.525 0.00 PCR-RFLP
ShenZhen15 260 0.232 0.185 0.583 0.00 PCR-SSP
Qinduo16 19953 0.2173 0.2438 0.5389 nt serologic
Shandong17 14207 0.2179 0.2512 0.5309 nt serologic
nt: not tested
I M M U N O H E M A T O L O G Y, V O L U M E  2 1 , N U M B E R  1 , 2 0 0 5 13
Blood group systems in indigenous Chinese
Colton
We typed for Coa and Cob alleles. Among 103 Hans,
62 Shes, and 102 Yugus,we detected only Coa/Coa. The
frequency of the Coa allele was 1.00 in all three of these
ethnic populations.
Other studies in Chinese Han
We reviewed articles on ABO genotypes among
Chinese populations published in Chinese-language
journals (Table 3). The allele frequencies for ABO in
the Han population were similar in all articles.
Discussion
In our study, the most frequent ABO allele among
Han Chinese was O1 (0.638), which is similar to the
frequency reported in other studies in Chinese-
language publications (0.504–0.583) (Table 3) and in
other Asian populations.18 Among Caucasian donors in
Europe, Australia, and the United States, approximately
2 to 6 percent of O alleles are O2. O2 was not detected
in the present study, which is consistent with previous
findings in Asian populations.18
Two homologous genes, RHD and RHCE, encode
Rh antigens. RHD codes for the D antigen, and RHCE
codes for the Cc and Ee antigens. The molecular basis
of the D– phenotype among Chinese may be the
absence of the RHD gene, a partial deletion, or the
absence of an intact RHD gene.19 Therefore, PCR is not
readily suited for D genotyping in this population. We
used conventional serologic methods to type for the D
antigen. The frequency of D+ was 99.6 percent in
Hans.Only 0.4 percent of the population was D–.Using
PCR, we typed the RHCE allele (C,c,E,e). RHCE allele
frequencies are obviously different between D+ and D–
Hans because of different populational haplotype
frequencies. In addition, cis and trans effects of RHCE
alleles upon D antigen expression are known, but their
magnitude in this population cannot be determined
from the design of the current study, which did not
include antigen density studies.
We also determined selected blood group
genotypes among She, Yugu, and Tajik minority
populations. The Chinese population includes 56
ethnic groups; 92 percent of the population is Han and
the other 8 percent represent 55 minorities. In this
study, MN allele frequencies are significantly different
between Han and Tajik populations. We did not find Ytb
in Hans, a distinct population characteristic that was
reported previously by Peng et al.20 We identified the
Ytb allele among Tajiks, whose Yt allele frequencies
were similar to those of Caucasians.18 We did not find
Sc2 among Hans or Tajiks; nor did we find Cob among
Hans, Shes, or Yugus. These genes may be absent in
Chinese populations.
The findings of this pilot study demonstrate that
blood group genotypes not only distinguish Asian from
European populations, but also illustrate the varied
genetic compositions of different Chinese ethnic
populations. Most studies of blood groups among
Chinese have been conducted by serologic methods
among emigrant Chinese. The results of this pilot study
encourage us to pursue further studies of the genetic
diversity among indigenous ethnic and minority
Chinese populations.
References
1. Mourant AE. Blood relations/blood groups and
anthropology. Oxford: Oxford University Press,
1985:15:59-72.
2. Gassner C, Schmarda A, Nussbaumer W, et al. ABO
glycosyltransferase genotyping by polymerase
chain sequence specific primers. Blood 1996;88:
1852-6.
3. Avent ND. Antenatal genotyping of the blood
groups of the fetus. Vox Sang 1998;74(suppl):
2365-74.
4. Faas BHW, Simsek S, Bleeker PMM, et al. RHE/e
genotyping by allele-specific primer amplification.
Blood 1995;85:829-32.
5. Eshleman JR, Shakin-Eshleman SH, Church A, et al.
DNA typing of the human MN and Ss blood group
antigens in amniotic fluid and following massive
transfusion.Am J Clin Pathol 1995;103:353-6.
6. Olsson ML, Hansson C,Avent ND, et al.A clinically
applicable method for determining the three
major alleles at the Duffy (FY) blood group locus
using polymerase chain reaction with allele
specific primers.Transfusion 1998;38:168-73.
7. Irshaid NM, Thuresson B, Olsson ML. Genomic
typing of the Kidd blood group locus by a single
tube allele specific primer PCR technique. Br J
Haematol 1998;102:1010-4.
8. Mengli L, Dongling J. Distribution of Yt blood
group in Xian Han population. Chin J of Blood
Transfus 2002;15:320-1.
9. Wagner FF, Poole J, Flegel W. Scianna antigens
including Rd are expressed by ERMAP. Blood
2003;101:752-7.
10. Joshi SR,Wagner FF,Vasantha K, et al.An AQP1 null
allele in an Indian woman with Co(a–b–)
14 I M M U N O H E M A T O L O G Y, V O L U M E  2 1 , N U M B E R  1 , 2 0 0 5
L.YAN ET AL.
phenotype and high-titer anti-Co3 associated with
mild HDN.Transfusion 2001;41:1273-8.
11. Zhong L, Qing F, Rong L, et al. Study of
identification and polymorphism distribution of
human blood type ABO genotypes.Chin J of Blood
Transfus 1998;11:178-80.
12. Qingen Y, Chuanhong ZH. Detection of ABO
genotypes by simultaneous PCR-RFLP method.
Chin J Med Genet 1999;16:110-2.
13. Jiongcai L, Qingbao M,Yinze ZH, et al. Genotyping
of ABO blood group and its application. Chin
Immunol J 2002;18:430-3.
14. Zhonghui G,Dazhuang L,Ziyan Zhu,et al. Study on
ABO genotype in Chinese Han population. Journal
of Clin Transfus Lab Med 2002;l4:6-8.
15. Qiong Y, Guogang W, Yanlian L, et al. Study on
genotyping of ABO blood group and its
application in Chinese Han population. Med Lab
of Jiangxi 2003;21:133-6.
16. Yuqin W,Qi Y.Distribution of ABO and Rh group in
Qingduo. Chin J of Blood Transfus 1997;10:150.
17. Qun X,Zhaoyong SH,Shixun ZH,et al.Distribution
of ABO, Rh, MN, P groups in Shangdong. Chin J of
Blood Transfus 1995;8:211.
18. Daniels G. Human blood groups. 2nd ed. Oxford:
Blackwell Science Ltd. 2002:16-22,369-71.
19. Ji H, Qihua F, Lei J, et al.Analysis of Del phenotype
and RHD gene in RhD negative phenotype. J of
Shanghai Med Lab 2002;17:90-2.
20. Peng CT,Tsai CH, Lee HH, et al. Molecular analysis
of Duffy,Yt,and Colton blood groups in Taiwanese,
Filipinos and Thais. Kaohsiung J Med Sci
2000;16:63-7.
Lixing Yan, MD; Faming Zhu, MD; Qihua Fu, MD; and
Ji He, BA, Institute of Transfusion Medicine, Blood
Center of Zhejiang Province, Wulin Road 345,
Hangzhou, Zhejiang 310006, P.R. China


ABO, Rh, MNS, Duffy, Kidd, Yt, Scianna, and Colton blood group systems in indigenous Chinese

Jeremiah, Z. Awortu

Odumody, Chris

I M M U N O H E M A T O L O G Y, V O L U M E  2 1 , N U M B E R  1 , 2 0 0 5 21
This report forms part of the study on the Rh phenotypes within
the various ethnic nationalities in the south-south region of Nigeria.
The aim is to demonstrate the Rh polymorphisms among the
people of African descent. The frequencies of Rh blood group
antigens and phenotypes of the Ibibio, Efik, and Ibo ethnic
nationalities in Calabar municipality, Nigeria, were determined
using standard serologic techniques. Of the 720 Calabar individuals
tested, the frequencies of the Rh antigens within the nationalities
were c (100%), e (96.38%), D (96.38%), E (15.22%), and C (3.62%)
for the Ibibios; c (100%), e (95.60%), D (96.70%), E (21.98%), and C
(0%) for the Efiks; and c (100%),e (94.29%),D (91.43%),E (28.57%),
and C (2.86%) for the Ibos. The overall frequencies of the Rh
antigens in these 720 individuals were c (100%), e (95.56%), D
(94.44%), E (18.89%), and C (2.78%). Forty (5.56%) were found to
be D–, while all were found to possess the c antigen. The most
frequently occurring Rh phenotype was Dccee,with a frequency of
73.61 percent. The alternative allele, C, did not appear in
homozygous form (CC) in the population tested. This study further
demonstrates the variability of Rh blood group phenotypes in
Nigeria and Africa. Immunohematology 2005;21:21–24.
Key Words: Rh antigens, Rh phenotypes, Ibibio, Efik,
Ibo, Nigeria
A total of 29 blood group systems have been
recognized by the ISBT Working Party on Terminology
for Red Cell Surface Antigens.1 Rh remains the most
complex and polymorphic of the blood group
systems.2,3 Antibodies developed against these antigens
have been known to cause HDN.4–6 In addition, the
distribution and frequencies of these antigens have
been known to vary between racial groups.2,3,7
Nigeria is a multiethnic country whose peoples
include the Ijaws, Ogonis, Ikwerres, Ibibios, Ekpeyes,
Annangs, Itsekiris, Binis, Urhobos, Isokos, Yorubas,
Hausa/Fulani, Ibos,Tivs, Jukuns,and Efiks.8 Among these
ethnic nationalities, the Rh blood group phenotypes 
of the Yorubas (Western Nigeria), Hausa/Fulani
(Northern Nigeria), and Ibos (Eastern Nigeria) have
been reported.9–11 In a recent study conducted in Port
Harcourt (South-South Nigeria), the Rh phenotypes of
the four main ethnic groups, Ijaws, Ikwerre,Ekpeye,and
Ogoni,were reported.12 There are no published data on
the Rh phenotypes among other ethnic nationalities in
the south-south region of Nigeria.
In this report, the Ibibio, Efik, and Ibo ethnic
nationalities in Calabar, Nigeria, were randomly
selected for study and their Rh phenotypes
determined. It is hoped that the data generated from
this study will provide information on the Rh antigens
and phenotype frequencies of the ethnic nationalities
of the people of South-South Nigeria. Also the study
seeks to demonstrate the variability and polymorphism
of the blood group antigens among the ethnic groups
in Nigeria.
Materials and Methods
Subjects
A total of 720 persons of both sexes and of various
ages and ethnic backgrounds randomly selected from
patients and donors at the University of Calabar
Teaching Hospital (UCTH); the staff of UCTH; students
at the School of Medical Laboratory Sciences, UCTH,
Calabar; and students of Holy Child Secondary School;
all in the Calabar metropolis, were recruited into the
study. The study population consisted of three ethnic
nationalities: Ibibio (276), Efik (182), and Ibo (70). The
remaining 192 were people of other groups in Nigeria.
Serology
Venous blood (2 mL) was collected from each of
the 720 persons into EDTA tubes. RBCs were pheno-
typed for D,C,E,c,and e antigens according to standard
Rh antigens and phenotype
frequencies of the Ibibio, Efik,
and Ibo ethnic nationalities in
Calabar, Nigeria
Z.A. JEREMIAH AND C. ODUMODY
22 I M M U N O H E M A T O L O G Y, V O L U M E  2 1 , N U M B E R  1 , 2 0 0 5
Z.A. JEREMIAH AND C. ODUMODY
serologic protocols (tube method)13 with an IgM anti-D
MoAb (IG 1017) and IgM MoAbs specific for C (AC
2207), c (RH 1268), E (ME 093), and e (AE) 3080
(BIOTEC, Ipswich, Suffolk, UK). Albumin 30% (RE
2728) and an anti-CDE MoAb (CDE 490) were also
used. Six tubes were arranged in a row and labeled
anti-D, –C, –E, –c, –e, and autocontrol. Two drops of
antisera and one drop of a 5% washed RBC suspension
were added to each tube. This was followed by
incubation at 37°C for 30 minutes. At the end of 30
minutes, the tubes were centrifuged and the
agglutination was read macroscopically. All of the
negative results were confirmed microscopically. Anti-
CDE, albumin, and antihuman globulin (AHG) tests
were used as controls and for weak D determination.
To determine the presence of weak D antigen, one
drop of anti-CDE reagent and one drop of the RBC
suspension were added to a labeled test tube and
incubated at 37°C for 30 minutes. Agglutination was
read macroscopically and confirmed microscopically.
In the final stage, bovine albumin was added to the test
and further incubated at 37°C for 30 minutes. At the
end of the incubation, the test was washed three times
with 0.9% physiological saline. The RBC button was
resuspended and one drop of AHG reagent was added.
Agglutination at this stage confirmed the presence of
weak D antigen.
Statistical method
We calculated allele frequencies under the standard
assumption of a Hardy-Weinberg equilibrium, using the
counting method of Cepellini et al.14 Frequencies of
the Rh antigens were obtained using chi-square
analysis. Results were expressed as a percentage.
Results
Seven hundred and twenty individuals of both
sexes and of various ages residing in the Calabar
municipality in South-East Nigeria were randomly
screened for the presence of Rh antigens.
Table 1 shows the frequency (%) of the five Rh
antigens in the population. The c antigen was found to
have the highest frequency (100%), followed by e and
D antigens (95.56% and 94.44%, respectively). The E
and C antigens were found to have the lowest
frequency in the population (18.89% and 2.78%,
respectively). The Rh phenotype frequencies in the
population are as shown in Table 2. Seven phenotypes
were found to occur in the population, the most
common being Dccee (73.61%). Ccee was the most
rare phenotype in the population (0.28%). Of the 40
subjects that were D–, 38 were ccee, while only two
were Ccee.
Table 3 shows the occurrence of the Rh antigens
and the probable genotypes in the populations studied.
It is noteworthy that apparent homozygosity for cc, ee,
and EE genes is found in 97.22 percent, 81.12 percent,
and 4.44 percent of the population, respectively.
Apparent homozygosity of C was not found among the
samples tested. Weak D antigen was not encountered
in this study. Variant e+ phenotypes such as hrS– and
hrB– phenotypes and the r´S phenotype with altered C
expression could not be tested for.
Table 4 shows the distribution of the Rh antigens in
the three main groups in Calabar. The c antigen was
present in every individual irrespective of his or her
ethnic nationality. The e antigen has a very high
Table 1. Rh antigen frequency of the 720 Calabar participants
Rh antigen Number positive (%) Number negative (%)
D 680 (94.44) 40 (5.56)
C 20 (2.78) 700 (97.22)
E 136 (18.89) 584 (81.11)
c 720 (100) 0
e 688 (95.56) 32 (4.44)
Table 2. Probable Rh phenotypes and most probable genotypes of the
720 Calabar participants
Probable Rh Most probable
phenotype Number positive (%) genotype*
Dccee 530 (73.61) (R0R0)
DccEe 100 (13.89) (R0R2)
ccee 38 (5.27) (rr)
DccEE 32 (4.44) (R2R2)
DCcee 41 (1.94) (R0R1)
DCcEe 4 (0.56) (R0Rz)
Ccee 2 (0.28) (rr1)
*Obtained from Calculator for Rh genotype determination, Ortho-Clinical diagnostics,
Raritan, New Jersey
Table 3. RH genes and their occurrence in the 720 Calabar participants
Probable gene combination Number (% )
cc 700 (97.22)
Cc 20 (2.78)
CC 0 (0)
ee 584 (81.12)
Ee 104 (14.44)
EE 32 (4.44)
DD 680 (94.44)
Dd*
dd* 40 (5.56)
*d denotes absence of functional RHD gene.
}
I M M U N O H E M A T O L O G Y, V O L U M E  2 1 , N U M B E R  1 , 2 0 0 5 23
Rh phenotypes in Calabar, Nigeria
frequency within each of the three groups. The highest
frequency (96.38%) was recorded for the Ibibios, while
the lowest (94.29%) was recorded for the Ibos. None
of the Efik subjects had the C gene and very low
frequencies of 2.86% and 3.62% were recorded for the
Ibo and Ibibio subjects, respectively.
Discussion
This report forms part of the study on the Rh
phenotypes within the various ethnic nationalities in
Nigeria. The aim of the study was to demonstrate the
ethnic variations of the Rh antigens and how
polymorphic the Rh blood group can be in Nigeria.
The results obtained in this study were dependent on
the genetic constitution of the individuals tested and
not on sex, age, or disease conditions. All the subjects
resided in Calabar, which is the administrative head of
the then South-East Nigeria (now split into Cross Rivers
State and Akwa Ibom States) with Ibibios, Efiks, and
Ibos as the main ethnic groups.
In this study, the c antigen was detected in all
subjects (100%) and the results show that 97.22
percent of the 720 persons tested were homozygous
for c. There were no c– individuals recorded, so the
possibility of HDN due to anti-c in this population is
minimal when viewed against the report of Frazer and
Tovey,15 where 12 percent of the cases of HDN in
Southwest England were due to anti-c. We had
expected anti-C to occur more frequently in this
population: only 2.78 percent were found to possess
the C antigen in single dose. It is interesting to observe
in this study that none of the 182 Efiks enlisted in this
study possessed the C antigen. This may be of great
importance in anthropological studies of the Efik
ethnic nationality. The frequency of the c antigen in
this study is quite similar to the 99.8 percent frequency
obtained recently in Port Harcourt.12 There is,
however, a marked difference in the occurrence of the
C antigen, i.e., 17.7 percent was recorded in the Port
Harcourt population.12 Previous studies in Nigeria
showed a frequency of 26.9 percent of the C antigen
among the Yorubas10 and 43.7 percent among the
Ibos.11 These values, when compared with the 2.78
percent frequency of C antigen in the Calabar
population, demonstrate a wide variation in the
frequency distribution of Rh antigens within various
ethnic groups in Nigeria. In addition,Worlledge et al.10
reported that 40 (25%) Rh D– Ibo donors at UCH
Ibadan possessed the C antigen, whereas in Calabar
only 2.86 percent of 70 random Ibo subjects possessed
the C antigen. Various reports seem to support that c
is a high-frequency antigen in Nigeria (96.4% in Yoruba,
99.8% in Port Harcourt, 92.7% in Ibo, and 100% in the
Calabar population).10–12
There was a marked difference in the frequency of
the E antigen among the three groups. The highest
frequency (28.57%) was among the Ibos, with 21.98
percent and 15.22 percent among Efiks and Ibibios,
respectively, while 19.8 percent and 20.5 percent were
previously documented for the Yoruba and Port
Harcourt populations, respectively.10–12 With the low
frequency of the E antigen in Calabar, the possibility of
having individuals with naturally occurring anti-E
should be considered, because it could affect a major
crossmatch if the donor RBCs encountered are positive
for the E antigen.
Of the 40 (5.56%) D– individuals found in this study,
38 were of the phenotype ccee, while only two were
Ccee. None of the D– individuals were E+, suggesting
that E is usually present on the RBCs of D+ individuals.
The frequency of the D antigen in this study was 94.44
percent, very close to the Port Harcourt value of 95
percent. From calculations using the Hardy-Weinberg
formula, it was found that 61.8 percent of the D+
individuals were probably homozygous for the D gene
and will therefore pass on a D gene to each of their
offspring. Rh D– wives of such men have a greater
chance of having children with HDN due to anti-D. This
clearly contradicts the statement of Dacie and Lewis16
that the chances of being homozygous for D in Nigeria
are so high that every Rh-positive person must be
assumed to be homozygous for the D gene, because
only 61.8 percent of all D+ individuals in Calabar were
calculated to be homozygous for the D gene.
The Dccee phenotype was found to be the most
common in Calabar,with a frequency of 73.61 percent.
Results obtained from this study further
demonstrate the great variability of Rh antigens within
Table 4. Distribution of the Rh antigens within the three main ethnic
groups tested in Calabar 
Ethnic nationalities*
Number (%)
Rh antigen Ibibio Efik Ibo
c 276 (100) 182 (100) 70 (100)
e 266 (96.38) 174 (95.60) 66 (94.29)
D 266 (96.38) 176 (96.70) 64 (91.43)
E 42 (15.22) 40 (21.98) 20 (28.57)
C 10 (3.62) 0 (0) 2 (2.86)
*Only the frequencies within the three main ethnic nationalities were compared.
Minor groups were not included.
24 I M M U N O H E M A T O L O G Y, V O L U M E  2 1 , N U M B E R  1 , 2 0 0 5
Z.A. JEREMIAH AND C. ODUMODY
the various ethnic groups in Nigeria. Differences in
Ibibio, Efik, and Ibo Rh phenotype frequencies are
further proof of Rh polymorphism in blacks. These
results are of both clinical and anthropological interest.
References
1. Daniels GL, Cartron JP, Fletcher A., et al.
International Society of Blood Transfusion
Working Party on Terminology for red cell surface
antigens. Vox Sang 2003;84:244-7.
2. Race RR, Sanger R. Blood groups in man. 6th ed.
Oxford: Blackwell Scientific Publications,
1975:179–260.
3. Rupee C, Myers J, Gindy L. Blood groups, In: Petz
LD, Swisher SN, Kleinan S, Spencer RK, Strauss RG,
eds. Clinical practice of transfusion medicine. 3rd
ed. New York: Churchill Livingstone, 1996:71–151.
4. Knowles S, Poole G. Human blood group systems.
In: Murphy MF, Pamphilon DH, eds. Practical
transfusion medicine. 1st ed. London: Blackwell
Scientific Publications, 2002;24–31.
5. Bowman JM. Maternal alloimmunization and fetal
hemolytic disease. In: Reace EA, Hobbins JC,
Mahoney MJ, Petrie RH, eds. Medicine of the fetus
and mother. Philadelphia: JB Lippincott,
1992:1152–4.
6. Jovanovic-Srzentic S, Djokic M, Tijanic N, et al.
Antibodies detected in samples from 21,730
pregnant women. Immunohematology 2003;19:
89–91.
7. Issitt PD. Applied blood group serology. 3rd ed.
Miami: Montgomery Scientific Publications,
1985:105–10.
8. Niger Delta Ethnic Nationalities. Conference on
sustainable development and conflict resolution
in the Niger Delta. Feb. 4–6, 1999.
9. Onwukeme KE. Blood group distribution in blood
donors in a Nigerian population. Niger J Physiol
Sci 1990;6:67–70.
10. Worlledge S, Ogiemudia SE,Thomas CO, Ikoku BN
Luzzatto. Blood group antigens and antibodies in
Nigeria. Ann Trop Med Parasitol 1974;68:249–64.
11. Ukaejiofor EO, Okonkwo WE, Tagbo EN, Emeribe
AO. ABO and Rhesus in a Nigerian population In:
Blood transfusion in the tropics. 1st ed. Nigeria:
Salem Media, 1996:38–9.
12. Jeremiah ZA, Buseri FI. Rh antigen and phenotype
frequencies and probable genotypes for the four
main ethnic groups in Port Harcourt, Nigeria.
Immunohematology 2003;19:86–88.
13. Judd JW. Methods in immunohematology. 2nd ed.
Durham: Montgomery Scientific Publication,
1998:2–3.
14. Cepellini R, Siniscalco M, Smith CAB. The
estimation of gene frequencies in a random
mating population. Am Hum Genet 1955;22:
97–114.
15. Frazer ID, Tovey GH. Haemolytic disease of the
newborn due to antibodies other than D. Br Med
J 1981;283:514–5.
16. Dacie JV, Lewis SM. Practical Haematology. 5th ed.
London: Churchill Livingstone, 1982:515–36.
Z. Awortu Jeremiah, MSc, AMLSCN Lecturer/Career
Medical Scientist (Haematology/Immunohaematol-
ogy), College of Health Science and Technology,
Kilometer 6 (Mile 4), Rumueme, Port Harcourt,
Nigeria, and Ministry of Health, Rivers State; and
Chris Odumody, AMLSCN, Medical Laboratory
Scientist, Rehoboth Specialist Hospital, Port Harcourt,
Nigeria.
REMEMBER:  THE PASSWORD IS “2000” For www.redcross.org/pubs/immuno
Now, as a subscriber, you can enter the password, 2000, and access the back issues. That means
cover to cover!  You will receive every article in total, every letter to the editor, every review, every ad, every
notice, and every literature review!  All of the other services will continue to be available on the Web site,
including sending a letter to the editor, subscribing with a credit card on the secure order site, performing a
literature search, reviewing instructions for authors, and linking to other important sites. Log on now to see
this great service!


Rh antigens and phenotype frequencies of the Ibibio, Efik, and Ibo ethnic nationalities in Calabar, Nigeria

Not a member yet

MNS blood group system: a review

Platelet additive solutions: current status

Case report:moderate hemolytic disease of the newborn due to anti-G

Chimerism and mosaicism are important causes of ABO phenotype and genotype discrepancies

A reminder that ZZAP reagent removes complement in addition to IgG from coated RBCs

ABO, Rh, MNS, Duffy, Kidd, Yt, Scianna, and Colton blood group systems in indigenous Chinese

Rh antigens and phenotype frequencies of the Ibibio, Efik, and Ibo ethnic nationalities in Calabar, Nigeria

Acute hemolytic transfusion reaction secondary to anti-Fy3

Novel molecular basis of an Inab phenotype

Review: acute Donath-Landsteiner hemolytic anemia

4,746

6,096