886 research outputs found

    FIGURE 5 in The mitochondrial genome of Smerinthus planus (Lepidoptera: Sphingidae) and its comparative analysis with other Lepidoptera species

    No full text
    FIGURE 5. Putative secondary structures of the 22 tRNA genes of the Smerinthus planus mitochondrial genome.Published as part of Wu, Lingling, Jiang, Xiaoli, Xie, Fengjiao, Kausar, Saima, Liang, Dan, Wei, Guoqing, Zhu, Baojian, Wang, Lei, Liu, Chaoliang & Qian, Cen, 2020, The mitochondrial genome of Smerinthus planus (Lepidoptera: Sphingidae) and its comparative analysis with other Lepidoptera species, pp. 533-552 in Zootaxa 4821 (3) on page 542, DOI: 10.11646/zootaxa.4821.3.6, http://zenodo.org/record/440109

    FIGURE 6 in The mitochondrial genome of Smerinthus planus (Lepidoptera: Sphingidae) and its comparative analysis with other Lepidoptera species

    No full text
    FIGURE 6. Sequence alignment of PCG and tRNA regions from 27 different Lepidoptera species. 6A, The color sequence part is motif AAGATAGAAACCAACCTGGCTYACACCGGTTTGAACTCAGATCATGTAAG; 6B, The color sequence part is motif GAAGAATGAACTAAAGCAGAAACWGGAGTWGGAGCWGCTATAGCWGCWGG; 6C, The color sequence part is motif AAYCCWGAAACTAATTCTCTTTCHCCTTCAGCAAAATCAAAAGGAGTWCG.Published as part of Wu, Lingling, Jiang, Xiaoli, Xie, Fengjiao, Kausar, Saima, Liang, Dan, Wei, Guoqing, Zhu, Baojian, Wang, Lei, Liu, Chaoliang & Qian, Cen, 2020, The mitochondrial genome of Smerinthus planus (Lepidoptera: Sphingidae) and its comparative analysis with other Lepidoptera species, pp. 533-552 in Zootaxa 4821 (3) on page 543, DOI: 10.11646/zootaxa.4821.3.6, http://zenodo.org/record/440109

    FIGURE 2 in The mitochondrial genome of Smerinthus planus (Lepidoptera: Sphingidae) and its comparative analysis with other Lepidoptera species

    No full text
    FIGURE 2. Comparison of the codon usage patterns within the mitochondrial genome of different Lepidoptera species.Published as part of <i>Wu, Lingling, Jiang, Xiaoli, Xie, Fengjiao, Kausar, Saima, Liang, Dan, Wei, Guoqing, Zhu, Baojian, Wang, Lei, Liu, Chaoliang & Qian, Cen, 2020, The mitochondrial genome of Smerinthus planus (Lepidoptera: Sphingidae) and its comparative analysis with other Lepidoptera species, pp. 533-552 in Zootaxa 4821 (3)</i> on page 539, DOI: 10.11646/zootaxa.4821.3.6, <a href="http://zenodo.org/record/4401092">http://zenodo.org/record/4401092</a&gt

    FIGURE 1 in The mitochondrial genome of Smerinthus planus (Lepidoptera: Sphingidae) and its comparative analysis with other Lepidoptera species

    No full text
    FIGURE 1. Map of the mitogenome of S. planus. The tRNA genes are labeled according to the IUPAC-IUB single-letter amino acids: cox1, cox2 and cox3 refer to the cytochrome c oxidase subunits; cob refers to cytochrome b; nad1-nad6 refer to NADH dehydrogenase components; rrnL and rrnS refer to ribosomal RNAs. Gene named above the bar are located on major strand, while the others are located on minor strand.Published as part of Wu, Lingling, Jiang, Xiaoli, Xie, Fengjiao, Kausar, Saima, Liang, Dan, Wei, Guoqing, Zhu, Baojian, Wang, Lei, Liu, Chaoliang & Qian, Cen, 2020, The mitochondrial genome of Smerinthus planus (Lepidoptera: Sphingidae) and its comparative analysis with other Lepidoptera species, pp. 533-552 in Zootaxa 4821 (3) on page 537, DOI: 10.11646/zootaxa.4821.3.6, http://zenodo.org/record/440109

    Conspicuous consumption of young Chinese consumers

    No full text
    LINGLING, Z. Conspicuous consumption of young Chinese consumers. Bachelor thesis. Brno: Mendel University in Brno, 2021. With China’s social and economic development and the continuous improvement of the consumption level of contemporary young people, young consumer groups have higher and higher requirements for material conditions, and the influence of conspicuous consumption in daily life is becoming more and more significant. Understanding and analysis the conspicuous consumption of young consumer groups is of great significance to the development of enterprises. This thesis surveys young Chinese consumers aged 18–25 and collects key data through questionnaire surveys (n = 261) and interviews (n = 10). Performed statistics and analysis on the obtained data helped identify the reasons, main motives, and characteristics of conspicuous consumption of young Chinese consumers. Author also provides marketing advice for Chinese companies targeting young consumers

    Isolation, structure elucidation and racemization of (+)- and (-)-pratensilins A-C: Unprecedented spiro indolinone-naphthofuran alkaloids from a marine: Streptomyces sp

    No full text
    Three pairs of new enantiomeric alkaloids with an unprecedented spiro indolinone-naphthofuran skeleton were isolated from a marine Streptomyces sp. The pure enantiomers had a marked difference in the enantiomerization processes for the three compounds. DFT calculations in combination with chemical derivatization were performed to corroborate the racemization process via a keto-enol-type tautomerism

    Fast algorithm and surface integral equations for two-dimensional materials modeling

    No full text
    In this dissertation, a wide-band two-dimensional (2D) fast multipole algorithm (FMA) with a novel diagonalization form is presented. The conventional diagonalization of 2D FMA can be derived based on the interpretation of Parseval's theorem. The performance of FMA in the twilight zone (between the low-frequency and high-frequency regimes) is not good enough. By scaling special functions and applying discrete Fourier transform (DFT), the multipole expansions with dense matrices can be transformed to diagonal matrices with stable accuracy. Therefore a broadband 2D FMA with high efficiency and accuracy is achieved with a multi-level scheme. Then a metasurface platform to generate structured light at second harmonics is proposed with transition metal dichalcogenide (TMDC) flakes. With the aid of the electric field integral equation and impedance boundary condition, the surface currents on TMDC flakes can be calculated at fundamental frequencies. By applying three-fold rotational symmetry of the quadratically nonlinear susceptibility of TMDC monolayer, radial (or azimuthal) polarization and orbital angular momentum can be generated at second harmonics with linearly polarized and circularly polarized incident waves at the fundamental frequency, respectively. Finally, the radiative heat transfer between two graphene-wrapped objects with arbitrary shapes is studied by a fluctuating-surface current formulation derived from surface integral equations with impedance boundary conditions. The surface conductivity of graphene can be tuned by the temperature, chemical doping or electrical gating. The near-field thermal radiation can be enhanced due to graphene plasmonics in the terahertz regime. Off resonance, the graphene coating has a shielding effect on the dielectric bodies containing fluctuating-current sources. This formulation can be extended to the multi-body problem and other two-dimensional materials.Submission published under a 24 month embargo labeled 'Closed Access', the embargo will last until 2023-05-01The student, Lingling Meng, accepted the attached license on 2021-04-19 at 23:26.The student, Lingling Meng, submitted this Dissertation for approval on 2021-04-19 at 23:51.This Dissertation was approved for publication on 2021-04-21 at 13:58.DSpace SAF Submission Ingestion Package generated from Vireo submission #16433 on 2021-09-16 at 20:11:26Made available in DSpace on 2021-09-17T04:04:40Z (GMT). No. of bitstreams: 2 MENG-DISSERTATION-2021.pdf: 10600058 bytes, checksum: c4a16987c4a0fb838141c8a7223d9fcb (MD5) LICENSE.txt: 4210 bytes, checksum: 56ed1838f101a997e572c9f8a6f2c65c (MD5) Previous issue date: 2021-04-21Embargo set by: Seth Robbins for item 118685 Lift date: 2023-09-17T04:04:53Z Reason: Author requested closed access (OA after 2yrs) in Vireo ETD systemEmbargo set by: Seth Robbins for item 118685 Lift date: 2023-09-17T04:07:01Z Reason: Author requested closed access (OA after 2yrs) in Vireo ETD systemAuthor requested closed access (OA after 2yrs) in Vireo ETD systemLimite

    Dascillus liangshanensis Jin, Xie & Yang, 2016, sp. n.

    No full text
    <i>Dascillus liangshanensis</i> sp. n. <p>(Figs 1–11)</p> <p> <b>Etymology.</b> The species name refers to the type locality, Liangshan; adjective.</p> <p> <b>Diagnosis.</b> This species can be easily distinguished from <i>D. planus</i> Jin <i>et al.</i>, 2013 and <i>D. compressus</i> Jin <i>et al.</i>, 2013 by its pronotum widest just before base, ventral lobe of aedeagus apically rounded and apex of dorsal lobe not compressed. Additionally, it can be distinguished from all other <i>Dascillus</i> species by its elytral setae not forming any colour pattern, and by males having ventrite 5 with apex distinctly projected medially while tergite X is apically truncate.</p> <p> <b>Description.</b> Male (Fig. 2). Length 12.4–13.2 mm, width 5.4–5.5 mm. Body 2.2–2.4× longer than broad. Head, antennae, pronotum, scutellar shield and venter black, elytra dark brown, legs dark brown or black. Upper surfaces densely clothed in short and adpressed setae. Head, pronotal and elytral setae uniformly brown, not forming colour pattern, venter covered by brown dense pubescence.</p> <p>Head. Antennae reaching middle of elytra. Antennomere 3 about 2.7–2.9× as long as broad, 1.1–1.3× as long as antennomere 4; terminal antennomere distinctly longer than penultimate. Mandible strongly curved apically; incisor edge with two teeth. Apical palpomere of both maxilla and labium cylindrical to fusiform.</p> <p>Pronotum trapezoidal, 0.4–0.5× as long as wide, widest just before base; sides sinuate. Lateral carina narrowly explanate with marginal bead, edge smooth with distinct fringe of setae; anterior angles slightly prominent. Disc moderately convex, punctation coarse and dense.</p> <p>Pterothorax. Scutellar shield 0.9–1.0× as long as wide, truncate anteriorly, obtuse posteriorly. Elytra moderately convex, together 1.9–2.0× as long as wide, 5.2–5.3× as long as pronotum.</p> <p>Abdominal ventrites (Fig. 9) with glabrous spots on each side; ventrite 5 with apex distinctly projected medially, 0.4–0.5× as long as wide, 1.4–1.5× as long as ventrite 4. Sternite IX (Fig. 6) apex and base both broadly rounded, bearing uniformly short setae in middle and apical part. Posterior edge of tergite IX (Fig. 7) also broadly rounded. Tergite X longer than tergite IX, apically truncate.</p> <p>Aedeagus (Figs 3–5). Phallobase emarginate at base. Parameres approximately as long as phallobase, inner margin upturned apically, slender and narrowly rounded at apex. Ventral lobe obtuse at apex; dorsal lobe rounded at apex.</p> <p> <b>Female</b> (Fig. 1). Externally identical to male except for abdominal ventrite 5 (Fig. 8) truncate. Female genitalia weakly sclerotised with vagina and bursa copulatrix not clearly separated; bursa copulatrix without sclerites; spermatheca small and not sclerotised. Ovipositor (Fig. 10) short; paraprocts entirely sclerotised, without baculi, about as long as gonocoxites; proctiger absent; gonocoxites entirely sclerotised ventral of paraprocts, triangular and strongly bent, apices prominent, densely setose dorsally, without baculi; gonostyli absent.</p> <p> <b>Type material. Holotype</b> (♂): Sichuan, Liangshan, Longwo xiang, 20-vii-2010, Song He, Lingling Cao. Deposited in China West Normal University, Nanchong, China.</p> <p> <b>Paratypes</b> (6♂, 4♀): Sichuan, Liangshan, Meigu xian, Longfushan, 18-vii-2011, 2200m, Chaoming Jiang (6♂, 3♀); Sichuan, Longwo xiang, Liangshan, 20-vii-2010, Song He, Lingling Cao (1♀).</p> <p> <b>Distribution.</b> China: Sichuan (Fig. 11).</p> <p> We are deeply grateful to Prof. Aiming Shi and the China West Normal University for providing specimens under their care, to Prof. Hong Pang (Sun Yat-Sen University) for making specimens of other species of <i>Dascillus</i> available to us, to Ms. Azadeh Taghavian for her assistance during the visit to the Museum National d’Histoire Naturelle, and to Jiří Hájek and one anonymous reviewer for improving the manuscript. This work was funded by the National Natural Science Foundation of China (Grant No. 31601882) and Undergraduate Training Programs for Innovation and Entrepreneurship of Agriculture College, Yangtze University (Grant No. nxy1621).</p>Published as part of <i>Jin, Zhenyu, Xie, Guanglin & Yang, Qixin, 2016, Description of a new species of Dascillus Latreille from Sichuan, China (Coleoptera: Dascillidae), pp. 321-323 in Zootaxa 4200 (2)</i> on pages 321-323, DOI: 10.11646/zootaxa.4200.2.5, <a href="http://zenodo.org/record/182215">http://zenodo.org/record/182215</a&gt

    Visualized gender and gendered visuality: Love, marriage, and labor in contemporary Chinese women’s visual culture

    No full text
    Feminism was long sidelined as a bourgeois ideology in Communist China and has never fully recovered as the leading apparatus for female empowerment. Chinese women have made tremendous progress under the leadership of the Communist Party, but at the same time faced unprecedented challenges in contemporary Chinese society where social welfare for women is increasingly marketized. How do Chinese women empower themselves when transitioning first to a planned economy and then to a market economy? My dissertation project studies women’s empowerment stories through the cultural works of four women visual professionals each representing the zeitgeist of her era. Methodologically, I break the conventional artistic boundaries by using visual culture as the new umbrella term. I have utilized fieldwork in Beijing and interviews with artists in Beijing, Paris, and Washington D.C. In addition, I have drawn a wide range of theories liberally in order to best analyze theory-informed contemporary visual culture. Through close examinations of the women’s world represented in the visual works of Dong Kena, Li Shuang, Xiao Lu, and Cui Xiuwen, the dissertation reveals that productive work is a great empowering tool for women across different sociopolitical contexts in Communist China, that women turn to sisterhood for female empowerment, often disappointed at its limitation and even betrayal, and that women artists in the new millennium turn to spirituality to seek personal and artistic empowerment. The dissertation recognizes the many challenges facing Chinese feminism but nevertheless concludes optimistically regarding the alliance of spirituality and feminism and its empowering potentiality.Submission published under a 24 month embargo labeled 'Closed Access', the embargo will last until 2021-05-01The student, LingLing Yao, accepted the attached license on 2019-04-17 at 11:19.The student, LingLing Yao, submitted this Dissertation for approval on 2019-04-17 at 11:21.This Dissertation was approved for publication on 2019-04-17 at 16:50.DSpace SAF Submission Ingestion Package generated from Vireo submission #13706 on 2019-08-22 at 16:22:50Made available in DSpace on 2019-08-23T20:47:33Z (GMT). No. of bitstreams: 3 YAO-DISSERTATION-2019.pdf: 91152680 bytes, checksum: 70af8565ad74facfc62d1040710ae6b0 (MD5) LICENSE.txt: 4209 bytes, checksum: 8772822fdeb69365a9782eebdd0b881f (MD5) PROQUEST_LICENSE.txt: 4555 bytes, checksum: a1511067f7c77a244ede83ce7b9d06f6 (MD5) Previous issue date: 2019-04-17Embargo set by: Seth Robbins for item 112335 Lift date: 2021-08-23T20:47:38Z Reason: Author requested closed access (OA after 2yrs) in Vireo ETD systemEmbargo set by: Seth Robbins for item 112335 Lift date: 2021-08-23T20:48:32Z Reason: Author requested closed access (OA after 2yrs) in Vireo ETD systemU of I Only Restriction set for Item 112335 on 2021-04-28T21:24:36Z with date 2021-08-23 by [email protected] of I Only Restriction set for Item 112335 on 2021-04-28T21:24:41Z with date 2021-08-23 by [email protected] of I Only Restriction set for Item 112335 on 2021-05-07T14:52:31Z with date 2023-05-07 by [email protected] of I Only Restriction set for Item 112335 on 2021-05-07T14:52:51Z with date 2023-05-07 by [email protected] requested U of I access extension, which was approved by the Graduate College Thesis OfficeU of I Onl
    corecore