82,008 research outputs found
Myeloma-induced alloreactive T cells arising in myeloma-infiltrated bones include double-positive CD8(+)CD4(+) T cells: evidence from myeloma-bearing mouse model
Get PDFThe graft-versus-myeloma (GVM) effect represents a powerful form of immune attack exerted by alloreactive T cells against multiple myeloma cells, which leads to clinical responses in multiple myeloma transplant recipients. Whether myeloma cells are themselves able to induce alloreactive T cells capable of the GVM effect is not defined. Using adoptive transfer of T naive cells into myeloma-bearing mice (established by transplantation of human RPMI8226-TGL myeloma cells into CD122+ cell-depleted NOD/SCID hosts), we found that myeloma cells induced alloreactive T cells that suppressed myeloma growth and prolonged survival of T cell recipients. Myeloma-induced alloreactive T cells arising in the myeloma-infiltrated bones exerted cytotoxic activity against resident myeloma cells, but limited activity against control myeloma cells obtained from myeloma-bearing mice that did not receive T naive cells. These myeloma-induced alloreactive T cells were derived through multiple CD8+ T cell divisions and enriched in double-positive (DP) T cells coexpressing the CD8αα and CD4 coreceptors. MHC class I expression on myeloma cells and contact with T cells were required for CD8+ T cell divisions and DP-T cell development. DP-T cells present in myeloma-infiltrated bones contained a higher proportion of cells expressing cytotoxic mediators IFN-γ and/or perforin compared with single-positive CD8+ T cells, acquired the capacity to degranulate as measured by CD107 expression, and contributed to an elevated perforin level seen in the myeloma-infiltrated bones. These observations suggest that myeloma-induced alloreactive T cells arising in myeloma-infiltrated bones are enriched with DP-T cells equipped with cytotoxic effector functions that are likely to be involved in the GVM effect.Lisa M. Freeman, Alfred Lam, Eugene Petcu, Robert Smith, Ali Salajegheh, Peter Diamond, Andrew Zannettino, Andreas Evdokiou, John Luff, Pooi-Fong Wong, Dalia Khalil, Nigel Waterhouse, Frank Vari, Alison M. Rice, Laurence Catley, Derek N. J. Hart and Slavica Vuckovi
Megaselia borealizona Brown & Hartop & Wong 2022, New Species
No full textMegaselia borealizona New Species Fig. 16. urn:lsid:zoobank.org:act: 48C8F867-0149-4AAE-B345- CB228061530F Holotype Male. CANADA: Ontario: Bell Bay Provincial Park, 45.5151°N, 77.8181°W, 329 m, 16 July 2014, CBG Collections Staff [LACM ENT 336339] (BIOUG33263 -E02) (CNCI). Holotype Barcode AACTTTATATTTTATTTTTGGAGCATGAG CTGGAATAGTAGGAACTTCTTTAAGAATTATAATTCGAGCT GAATTAGGACATCCAGGAGCCTTAATTGGTGATGACCAGAT TTATAATGTAATTGTAACTGCACACGCATTTATTATAATTTT TTTTATAGTGATACCTATTATAATAGGAGGATTTGGAAATTG ATTAGTACCTTTAATATTAGGAGCCCCTGATATAGCTTTTC CACGTATAAATAATATAAGATTCTGAATATTACCTCCTTCAT TA AC T T TAC TAT TAG CA AG A AG T T TAG TAG A A A AT G G A A C T G G TA C A G G T T G A A C T G T T TA C C C T C C T T T AT C T T C TA G A AT T G C T C ATA G A G G AT C T T C T G T T G AT C T T G C A AT T T T T T C T C T T C AT C T C G C A G G A AT C T C T T C A AT T T TA G G A G C A G TA A AT T T TAT TA C TA C A AT TAT TA ATATA C G AT C AT C A G G G AT T T C T T T T G AT C G A ATA C C T T TAT T T G T T T G AT C T G TA G G TAT TA CAGCTTTACTTTTACTTTTATCTTTGCCTGTACTTGCAGG AGCTATTACTATACTTCTAACAGATCGAAATTTTAACACAT CATTTTTCGACCCAGCAGGAGGTGGAGATCCAATTTTATA TCAACACCTATTT Diagnosis. This holotype (and single known specimen) of this species differs from M. tropizona from Costa Rica, by a minimum of 2.03% (Fig. 1, Table 1). There are subtle wing venation differences between the two species, namely that in M. borealizona costal sector 3 is distinctly larger and sector 2 smaller (Fig. 16). The differences in distribution, northern Ontario, Canada versus Costa Rica, make it highly unlikely that M. borealizona and tropizona are the same species. Further collecting in northern Ontario to try to encounter more specimens of M. borealizona is warranted. This species is in BOLD as BOLD:ADJ4079. Distribution. Ontario, Canada. Etymology. The name is based on the boreal zone, in which this specimen was collected.Published as part of Brown, Brian V., Hartop, Emily A. & Wong, Maria A., 2022, Sixteen in One: White-Belted Megaselia Rondani (Diptera: Phoridae) From the New World Challenge Species Concepts, pp. 1-17 in Insect Systematics and Diversity 6 (3) on page 6, DOI: 10.1093/isd/ixac00
Settling of finite-size particles in isotropically forced, homogeneous turbulence: interface-resolved simulations
No full textWe have simulated the gravity-induced settling of finite-size particles in a turbulent background flow which is forced in a statistically-stationary fashion. The simulations are accurately resolving the solid-fluid interface with the aid of an immersed boundary technique [1]. The parameters of the simulation are (apart from background turbulence) identical to those of reference [2], where particle clustering was observed at a Galileo number of 178 and a solid volume fraction of 0.005. In the present case, it is found that a relative turbulence intensity of 0.24 leads to the disappearance of the clusters; as a consequence, the increase in average particle settling velocity found in [2] also vanishes. [1] M. Uhlmann. An immersed boundary method with direct forcing for the simulation of particulate flows. J. Comput. Phys., 209(2):448–476, 2005. [2] M. Uhlmann and T. Doychev. Sedimentation of a dilute suspension of rigid spheres at intermediate Galileo numbers: the effect of clustering upon the particle motion. J. Fluid Mech., 752:310–348, 2014
On The Wong-Zakai And Support Theorems For Stochastic Partial Differential Equations
No full textUniversity of Minnesota Ph.D. dissertation. May 2020. Major: Mathematics. Advisor: Nicolai Krylov. 1 computer file (PDF); v, 103 pages.The purpose of this thesis is to demonstrate how to obtain convergence results of Wong-Zakai type by using the -theory of SPDE. Let be a positive integer, be a sequence of independent Wiener processes, and be a cylindrical Wiener process on . We consider two parabolic stochastic partial differential equations (SPDEs) on the whole space: \begin{align*} du (t, x)& = [a^{i j} (t, x) D_{i j} u(t, x) + f(u, t, x)]\, dt + \sum_{k = 1}^m g^k (u(t, x)) dw^k (t), x \in \mathbb{R}^d,\\ % % dv (t, x)& = [a (t, x) D^2_{x} v (t, x) + b (t, x) D_x v (t, x) + f (v, t, x)] dt, \\ % & + v (t, x) dW(t), x \in \mathbb{R}. \end{align*} For the first equation we prove the convergence of a Wong-Zakai type approximation scheme in some H\"older-Bessel space in probability. We also prove a Stroock-Varadhan's type support theorem in H\"older-Bessel space for both equations. To prove the results we combine V. Mackevi\v cius's ideas from his papers on Wong-Zakai theorem and the support theorem for diffusion processes with N.V. Krylov's -theory of SPDEs.Yastrzhembskiy, Timur. (2020). On The Wong-Zakai And Support Theorems For Stochastic Partial Differential Equations. Retrieved from the University Digital Conservancy, https://hdl.handle.net/11299/215118
A characterization on trees with
Get PDFLet be the multiplicity of an eigenvalue of a
connected graph . Wang et al. [Linear Algebra Appl. 584(2020), 257-266]
proved that for any connected graph , , where and are the cyclomatic
number and the number of pendant vertices of , respectively. In the same
paper, they proposed the problem to characterize all connected graphs with
eigenvalue such that . Wong et al.
[Discrete Math. 347(2024), 113845] solved this problem for the case when is
a tree by characterizing all trees with eigenvalue such that . In this paper, we further provide the structural
characterization on trees with eigenvalue such that
Rhynchopyle loi S. Y. Wong & P. C. Boyce
No full textRhynchopyle loi (P.C.Boyce & S.Y.Wong) S.Y.Wong & P.C.Boyce Figure 6A Material examined. MALAYSIA – Tawau • Tawau Hills Park, trail to Bukit Gelas; 04°23′59″N, 117°53′21″E; 25 November 1998; J. T. Pereira 551 (SAN) • Tawau, Tawau Hills Park, Bukit Gelas Waterfall; 04°23′00″N, 117°53′00″E; 30 June 2006; Julia S. SAN 147860 (SAN) • Tawau River Forest Reserve; [04°24′40″N, 117°53′28″E]; 33 m (100 ft.) elev.; 6 July 1959; W. Meijer SAN 19468 (L). Identification. Flowering Rhynchopyle loi most closely resembles R. pileata (S.Y.Wong & P.C.Boyce) S.Y.Wong & P.C.Boyce by the deep magenta-purple strongly rostrate spathe limb. However, R. loi is readily differentiated by the spathe basally with a prominent ventral mentum, by the larger, centrally impressed interstice staminodes held in a zone wider than the remainder of the spadix, the stamens irregularly arranged (not carried in two rows), and the proportion- ately longer staminate flower zone. The leaves of R. loi are only ca. half as long as those of R. pileata, and much narrower; the entire plant is seldom exceeding 15 cm (Boyce and Wong 2013b). Distribution and ecology. Endemic to Sabah. Growing on bare or moss-covered basalt waterfall rocks under perhumid lowland forest; between 200 and 300 m elevation. Typically inhabits the steep banks of muddy, meandering lowland streams and, less frequently, the floor of lowlying forest where it may be inundated in wet periods.Published as part of Wong, Sin Yeng & Joling, Jyloerica, 2021, Checklist of aroids (Alismatales, Araceae) from Sabah (Malaysian Borneo), pp. 931-974 in Check List 17 (3) on page 961, DOI: 10.15560/17.3.93
Heterogeneous and tissue-specific regulation of effector T cell responses by IFN-gamma during Plasmodium berghei ANKA infection.
Get PDFIFN-γ and T cells are both required for the development of experimental cerebral malaria during Plasmodium berghei ANKA infection. Surprisingly, however, the role of IFN-γ in shaping the effector CD4(+) and CD8(+) T cell response during this infection has not been examined in detail. To address this, we have compared the effector T cell responses in wild-type and IFN-γ(-/-) mice during P. berghei ANKA infection. The expansion of splenic CD4(+) and CD8(+) T cells during P. berghei ANKA infection was unaffected by the absence of IFN-γ, but the contraction phase of the T cell response was significantly attenuated. Splenic T cell activation and effector function were essentially normal in IFN-γ(-/-) mice; however, the migration to, and accumulation of, effector CD4(+) and CD8(+) T cells in the lung, liver, and brain was altered in IFN-γ(-/-) mice. Interestingly, activation and accumulation of T cells in various nonlymphoid organs was differently affected by lack of IFN-γ, suggesting that IFN-γ influences T cell effector function to varying levels in different anatomical locations. Importantly, control of splenic T cell numbers during P. berghei ANKA infection depended on active IFN-γ-dependent environmental signals--leading to T cell apoptosis--rather than upon intrinsic alterations in T cell programming. To our knowledge, this is the first study to fully investigate the role of IFN-γ in modulating T cell function during P. berghei ANKA infection and reveals that IFN-γ is required for efficient contraction of the pool of activated T cells
Mesophilic-hydrothermal-thermophilic (M-H-T) digestion of green corn straw
No full textMesophilic-hydrothermal (80-160 degrees C, 30 min)-thermophilic (M-H-T) digestion and control tests of mesophilic (M), thermophilic (T), hydrothermal-mesophilic (H-M), and mesophilic-thermophilic digestion (M-T) of green corn straw were conducted for a 20-day fermentation period. The results indicate that M-H-T is an efficient method to improve methane production. A maximum methane yield of 371.74 mL/g volatile solid was obtained by the M (3 days)-H (140 degrees C)-T (17 days) process, which was 20.44%, 16.55%, 31.44%, and 14.31% higher than the yields of the M, T, 140-M, and M-T processes. The enhanced methane production was attributed to (1) the improved hemicellulose degradation and lignin disorganization; (2) prevention of the degradation of soluble sugar, easily hydrolyzed hemicellulose and cellulose into furfural and methylfurfural; and (3) lack of formation of Maillard reaction products during initial hydrothermal treatment. (C) 2015 Elsevier Ltd. All rights reserved
Dr. Glendon Swarthout
No full textHosted by Roger M. Busfield, MSU Assistant Professor of Speech and Theater, Meet the Author is designed to introduce a general audience to a contemporary author and their work through in-depth interviews. This episode features a conversation between Dr. Glendon Swarthout, prolific author and English professor at MSU, and assistant professors Sam S. Baskett and Theodore B. Strandness
A Wong-Zakai type approximation for multiple Wiener-Stratonovich integrals
No full textWe present an extension of the Wong-Zakai type approximation theorem for a multiple stochastic integral. Using a piecewise linear approximation w((n)) of a Wiener process w, we prove that the multiple integral process {integral(0)(t)...integral(0)(t) f(t(1),..., t(m))dw(t1)(n...)dw(tm)(n), t is an element of [0, T]}, where f is a given symmetric function in the space C([0, T](m)), converge to the multiple Stratonovich integral of f in the uniform L-2-sense.
- …
