30 research outputs found
International Perspectives (1997-09)
No full textUniversity of Minnesota, Duluth. Royal D. Alworth, Jr. Institute for International Studies. (1997). International Perspectives (1997-09). Retrieved from the University Digital Conservancy, https://hdl.handle.net/11299/227388
Longitudinal outcome over two decades of unrelated allogeneic stem cell transplantation for relapsed/refractory acute myeloid leukemia: an ALWP/EBMT analysis
No full textStrategy for GCAP1 gene disruption.
No full text<p><b>A.</b> Schematic of the mouse <i>GUCA1A</i> gene disruption. The targeting construct was made by inserting the <i>PGK:Neo:tts</i> cassette <a href="http://www.plosone.org/article/info:doi/10.1371/journal.pone.0047637#pone.0047637-Tybulewicz1" target="_blank">[23]</a> between PCR-amplified 1.5-kb and 5-kb arms to replace the first exon of the <i>GUCA1A</i> gene together with the putative promoter region and a part of the first intron as described in detail in <a href="http://www.plosone.org/article/info:doi/10.1371/journal.pone.0047637#s2" target="_blank">Materials and Methods</a>. <i>K, M, N,</i> and <i>S</i> designate KpnI, MluI, NotI and SbfI restriction sites, respectively; <i>tts</i> – transcription termination site in <i>PGK:Neo</i> cassette. <b>B.</b> PCR products of WT allele (<i>top</i>) and the targeted KO allele (<i>bottom</i>), amplified from mouse tail DNA from littermates produced by breeding of GCAP1<sup>+/−</sup> parents using f3 (5′-CCTTGTGCAGGGGACATTAGAAAATAAG) and r3 (5′-CATCTGTTCCACATA CTGGCTGGCT) primers or f2 (5′- TGATATTGCTGAAGAGCTTGGCGGCGAAT) and r3 primers, respectively. <b>C.</b> Immunoblotting of SDS polyacrylamide gels containing retina samples from WT, GCAP1<sup>+/−</sup>, and GCAP1<sup>−/−</sup> littermates simultaneously probed with anti-rhodopsin and anti-GCAP1 polyclonal antibody. Retinas were homogenized in SDS sample buffer on ice and were not boiled prior to electrophoresis, in order to preserve rhodopsin monomer. <b>D.</b> GCAP immunofluorescence in retina cryosections from WT (<i>left panels</i>) and GCAP1<sup>−/−</sup> (<i>right panels</i>) mice probed with anti-GCAP1 (<i>upper panels</i>) or anti-GCAP2 (<i>bottom panels</i>) polyclonal antibody and developed with goat-anti rabbit FITC-labeled antibody. WT and GCAP1<sup>−/−</sup> retinas were fixed, processed and probed with each antibody under identical conditions; images were taken using identical laser settings and image acquisition parameters. One half of each panel also shows the anti-GCAP FITC fluorescence and nuclei counterstained with TO-PRO-3 iodide (<i>pseudo-blue</i>), superimposed on the DIC image of the same view field. Notice that the brightness of the anti-GCAP2 signal in the outer segment layer <i>versus</i> inner segment layer is slightly increased in the GCAP1<sup>−/−</sup> retinas (marked with the dashed lines in <i>lower two panels</i>). <b>E.</b> Hematoxylin/eosin-stained GCAP1<sup>−/−</sup> retinas at 6 months of age did not reveal evidence for retinal degeneration or other histological abnormalities when compared to the WT of the same age. Histological layers of the retina in <b>D</b> and <b>E</b> are marked as: <i>RPE</i>– retinal pigment epithelium, <i>OS</i>– photoreceptor outer segments, <i>IS</i>– inner segments, <i>ON</i>– outer nuclear layer, <i>OP</i>– outer plexiform layer, <i>IN</i>– inner nuclear layer, <i>IP</i> – inner plexiform layer, <i>GC</i> – ganglion cell layer. <b>F, G.</b> Representative electron micrographs of the WT and GCAP1<sup>−/−</sup> ROS morphology: cross-sections (<b>F</b>; bar size –1 µm) and radial sections (<b>G</b>; bar size –0.2 µm); negative contrast by osmium.</p
#commonize studio : Creating design briefs for disruptive economics
No full textWhat if we treat economics as design rather than social science? #commonize studio explores what a design studio that supports communities to build commons looks like. The projects supported so far range from a "soil trust" to upcycle food waste in Hong Kong to a "publiccommons partnership" for blood donation in Botswana. The approach in all of this work, which has evolved into a combination of designer and coach, is to develop the "things" that commons "instigators" need to build commons. The majority of what has been produced so far might be considered boundary objects -- translations of the commons literature that enable emerging communities to create their own commoning worlds. Examples range from broad frameworks (e.g. Commons Creation Framework) to activity-based tools (e.g. morethan-human member persona), and "commons planning" documents (e.g. pluriversal Commons Model Canvas). In this workshop, we will focus on the design brief. A design brief outlines the "client's" challenge and how they think the designer/s can solve it. "Creating design briefs for disruptive economics" is a workshop where willing participants can share their challenges, and we'll create design briefs through collective Q&A that address how we, as a momentary #commonize studio, might support the participant's progress
ANATOMY OF THE NUTRIENT FORAMEN ON THE HUMERUS, RADIUS AND ULNA: A REVIEW
No full textObjective: The nutrient foramina are reported as a cause for union defects in humerus, radius and ulna fractures. We aimed to review the relationship between the anatomy of the nutrient foramina and fractures of these bones
Osmose - User Manual version 2.0
No full textOSMOSE is a platform for the study and design of complex integrated energy systems. The software is developed in the Laboratory for Industrial Energy Systems (LENI) in the Ecole Polytechnique Fédérale de Lausanne (EPFL), Lausanne, Switzerland. The project is motivated by the need of a fexible and performant research tool to study and design energy systems. In this perspective, the general scope of the software is to help the user to develop and compute technology models that combine (a) thermodynamic computations, (b) power and energy integration as well as (c) economic or environomic aspects. OSMOSE , exploits the models by performing (a) sensitivity analysis, (b) optimization and (c) data analysis. The present document is a complete user guide to OSMOSE. In addition, elements of software structure and architecture are exposed. This makes therefore the document useful as an introduction for future developers in the project.SCI-STI-FMLEN
Analisis Faktor Pendorong India Menjalin Bilateral Trade Agreement dengan Mauritius dalam India-Mauritius Comprehensive Economic Cooperation and Partnership Agreement (CECPA)
No full textSebagai salah satu negara dengan pertumbuhan ekonomi tercepat di dunia, India
tentunya memiliki kepentingan untuk memperluas pengaruhnya di kawasan lain,
seperti Afrika. Guna mencapai tujuan tersebut, India kemudian menginisiasi
bilateral trade agreement dengan Mauritius, yang merupakan negara kepulauan
kecil di wilayah Samudra Hindia Barat. Perjanjian yang bertajuk India-Mauritius
Comprehensive Economic Cooperation and Partnership Agreement (CECPA)
tersebut ditandatangani pada tahun 2021 dan menjadi perjanjian dagang bilateral
pertama yang dilakukan India dengan negara Afrika. Mengacu pada hal tersebut,
maka penelitian ini bertujuan guna mendeskripsikan berbagai faktor pendorong
yang melatarbelakangi perumusan bilateral trade agreement antara India dan
Mauritius. Dalam penelitian ini, penulis menerapkan metode kualitatif dengan
pendekatan deksriptif. Melalui konsep bilateral trade agreement milik Jayant
Menon, diketahui bahwa sejumlah faktor umum dan spesifik mempengaruhi
terciptanya perjanjian dagang bilateral yang dijalin India dengan Mauritius
Animal milk, a miracle food or a real poison ?
No full textAnimal milk is widely consumed in the world, its composition in macro and micronutrient,its availability have made it a key element in the basic diet of individuals.Between anti-milk speeches and those who present it as a miracle food, the liquid isthe subject of many controversies.This article reviews the debate about the health effects of consuming animal milk andits derivatives
