322 research outputs found
Dipturus argentinensis Astarloa, Mabragaña & Hanner, 2008, n. sp.
No full text<i>Dipturus argentinensis</i> n. sp. <p>(Figure 1, Table 1)</p> <p> <i>Holotype</i>.— INIDEP 793, 765 mm TL, juvenile male, off central Patagonian continental shelf, 45º38’S, 64º08’W, 98 m, 21 January 2006, R/V DR. EDUARDO HOLMBERG, cruise H-01/06, sta. 38. GenBank Accession No. EU074410.</p> <p> <i>Paratypes</i>.— INIDEP 794, 935 mm TL, female, 46° 20´S, 64° 09´W, 95 m, 0 3 September 2002, R/V DR. EDUARDO HOLMBERG, cruise H-04/02, sta. 363. INIDEP 795, 632 mm TL, immature female, off south Patagonian continental shelf, 50º 15’ S, 63º 35’ W, 140 m, 14 February 2006, R/V DR. EDUARDO HOLMBERG, cruise H-02/06, sta. 28. GenBank Accession No. EU074411. INIDEP 796, 710 mm TL, immature male, off south Patagonian continental shelf, 47º 45’ S, 61º 28’ W, 142 m, 21 February 2005, R/V DR. EDUARDO HOLMBERG, cruise H-02/05, sta. 45. INIDEP 797, 617 mm TL, immature male, off south Patagonian continental shelf, 45º 18’ S, 64º 40’ W, 87 m, 20 January 2005, R/V DR. EDUARDO HOLMBERG, cruise H-01/05, sta. 34. INIDEP 798, 555 mm TL, immature male, off south Patagonian continental shelf, 45º 47’ S, 64º 47’ W, 96 m, 19 January 2006, R/V DR. EDUARDO HOLMBERG, cruise H-01/06, sta. 26. GenBank Accession No. EU074409. INIDEP 799, 403 mm TL, immature male, off south Patagonian continental shelf, 46º 03’ S, 66º 46’ W, 91 m, 15 January 2006, R/V DR. EDUARDO HOLMBERG, cruise H-01/06, sta. 7. GenBank Accession No. EU074405. INIDEP 800, 690 mm TL, immature male, off south Patagonian continental shelf, 45º 54’ S, 63º 10’ W, 97 m, 16 January 2005, R/V DR. EDUARDO HOLMBERG, cruise H-01/05, sta. 13. GenBank Accession No. EU074406. INIDEP 802, 522 mm TL, immature female, off south Patagonian continental shelf, 45º 54’ S, 63º 10’ W, 97 m, 16 January 2005, R/V DR. EDUARDO HOLMBERG, cruise H-01/05, sta. 13. GenBank Accession No. EU074408. INIDEP 803, 670 mm TL, immature female, off south Patagonian continental shelf, 45º 54’ S, 63º 10’ W, 97 m, 16 January 2005, R/V DR. EDUARDO HOLMBERG, cruise H-01/05, sta. 13. GenBank Accession No. EU074407.</p> <p> <b> <i>Diagnosis</i>.</b> <i>Dipturus argentinensis</i> is characterized by the combination of the following characters: dorsal surface of disc brown purplish with no distinct ocelli or blotches margined with dark brown on pectoral and pelvic fins. Upper surface of disc smooth except few small spinules scattered on tip of snout. Ocular thorns present, with scapular thorns absent. A single nuchal thorn either present or absent. One median row of 10 to 24 small caudal thorns. Dorsal and caudal fins scattered with very few spinules. One or two interdorsal thorns. Relatively long and thin tail, approximately half the total length. Ventral surface of disc as dark as the upper side, smooth except few small spinules scattered on tip of snout. Interbranchial space with no prickles.</p> <p> <b> <i>Description</i>.</b> Measurements and counts are given in Table 1. Differing values of the paratypes following those for the holotype are in parentheses. Disc rhombic, 1.24 times as broad as long (1.22-1.27); snout greatly elongated, 4.35 times in total length (4.54 to 5.26); Anterior margin of disc concave and posterior margin convex with rounded inner corner to level of pelvic fins. Orbit length 0.62 times (0.5 – 0.66) of interorbital length and 1.09 times spiracle length (1.14–1.58). Distance between spiracles 1.18 times that between orbits (1.16 – 1.36). Preorbital length 4.49 times (3.88 to 4.33) interorbital width. Tail very slender and relatively long with a thin lateral tail fold. Its length from center of cloaca to tip 0.82 times that from tip of snout to center of cloaca (0.84 to 0.95). Space between dorsal fins, 0.28 times (0.19–0.38) base of first dorsal fin. Height of dorsal fins greater than half their bases’ lengths. Preoral length 2.79 times mouth width (2.36 to 2.75). Preorbital length 7.29 times orbit length (6.24 to 7.88). Nostril flaps are short, thick and tube -like. Anterior nasal flap (nasal curtain) well developed and fringed along distal margin. Posterior nasal flap poorly developed and smooth. Mouth slightly arched. Upper and lower jaws with 37 and 38 (35 to 40, and 34 to 43) tooth rows, respectively. Distance between first gill slits 1.86 times distance between nares (1.71 to 1.91). Distance between fifth gill slits 1.06 times internarial distance (1.03 to 1.28). First dorsal fin about equal in size and shape to second dorsal fin. Dorsal side of disc smooth except few small spinules scattered on tip of snout (in one specimen the spinules also placed on both sides of eyes as well as in front of ocular region). Ventral side of disc, pelvics, claspers and tail without dermal denticles except few small spinules scattered on tip of snout. Midline of tail with 13 (10 to 24) small thorns, with oval bases and backwardly directed crowns.</p> <p> <b> <i>Coloration when fresh</i>.</b> Upper surface of disc plain purplish brown and margined with dark brown on pectoral and pelvic fins with no distinct ocelli or blotches. Thorns marked off pale milky-white pigment. Lateral tail folds creamy white pigment. Dorsal fins uniformly brown.</p> <p>Lower surface of the disc brownish on central part, becoming pale brown to outer parts of pectoral fins and with darker margins. Anterior lobes of pelvic fins dark brown whereas posterior ones are lighter and narrowly edged grey. Underside of tail uniformly brown with light margins at level of dorsal fins.</p> <p> <b> <i>Etymology</i>.</b> The specific epitet <i>argentinensis</i> is named in reference to the Argentine Sea where the type material was collected.</p> <p> <b> <i>Common name</i>.</b> New English name: Argentine Skate; new Spanish name: Raya hocicuda de cola larga.</p> <p> <b> <i>Barcode sequence</i>.</b> A 651 base pair amplicon from the 5´region of the mitochondrial COI gene was bidirectionally sequenced for the holotype and six paratypes (GenBank accession numbers EU074410, EU074405, EU074406, EU074407, EU074408, EU074409, EU074411, respectively). The holotype and five of the paratype sequences were virtually identical, while the seventh differed by only a single nucleotide (0.146 % sequence divergence). The mtDNA COI barcode profile of the holotype is reported herein as an aspect of the type description:</p> <p>CCTTTACTTAATTTTTGGTGCCTGAGCAGGCATGGTCGGGACTGGCCTAAGTCTTTTAATCCGAGC AGAACTAAGTCAACCCGGGACCCTCCTGGGTGACGATCAGATTTATAATGTCATTGTTACAGCCCA TGCCTTTGTAATAATCTTTTTTATGGTTATACCAATTATAATCGGCGGGTTTGGTAATTGACTCGTCC CTTTAATAATTGGCTCCCCCGACATGGCCTTCCCACGCATAAATAACATAAGTTTCTGACTTTTACC CCCCTCTTTTCTCCTCCTCCTGGCCTCCGCTGGAGTTGAGGCCGGGGCCGGAACAGGTTGAACTG TCTACCCCCCTCTGGCAGGAAATCTGGCCCACGCGGGGGCCTCCGTAGACTTAACAATTTTCTCT CTTCACTTGGCAGGTGTTTCATCTATTCTAGCCTCCATTAACTTCATCACCACAATTATTAACATAA AACCACCAGCAATCTCTCAATACCAGACACCCTTATTCGTGTGATCAATTCTTGTTACAACTGTTTT ACTTCTTATGGCCCTCCCAGTTCTAGCAGCCGGCATCACTATACTACTCACGGACCGTAATCTCAA CACAACTTTCTTTGACCCGGCTGGAGGGGGCGACCCCATTCTATACCAACACTT</p> <p>Details of the individuals sequenced along with those congeneric species for making comparisons are provided in Table 2.</p>Published as part of <i>Astarloa, Juan Martin Díaz De, Mabragaña, Ezequiel & Hanner, Robert, 2008, Morphological and molecular evidence for a new species of longnose skate (Rajiformes: Rajidae: Dipturus) from Argentinean waters based on DNA barcoding, pp. 35-46 in Zootaxa 1921</i> on pages 37-41, DOI: <a href="http://zenodo.org/record/184713">10.5281/zenodo.184713</a>
Molecular Taxonomy and Diversification of Atlantic Skates (Chondrichthyes, Rajiformes): Adding More Pieces to the Puzzle of Their Evolutionary History
No full textConservation and long-term management plans of marine species need to be based upon the universally recognized key-feature of species identity. This important assignment is particularly challenging in skates (Rajiformes) in which the phenotypic similarity between some taxa and the individual variability in others, hampers accurate species identification. Here, 432 individual skate samples collected from four major ocean areas of the Atlantic were barcoded and taxonomically analysed. A BOLD project ELASMO ATL was implemented with the aim of establishing a new fully available and well curated barcode library containing both biological and molecular information. The evolutionary histories of the 38 skate taxa were estimated with two concatenated mitochondrial markers (COI and NADH2) through Maximum Likelihood and Bayesian inference. New evolutionary lineages within the genus Raja were discovered off Angola, where paleogeographic history coupled with oceanographic discontinuities could have contributed to the establishment of isolated refugia, playing a fundamental role among skates’ speciation events. These data successfully resolved many taxonomic ambiguities, identified cryptic diversity within valid species and demonstrated a highly cohesive monophyletic clustering among the order, laying the background for further inference of evolutionary patterns suitable for addressing management and conservation issues
Supplementary material 2 from: Phillips JD, Athey TB.T, McNicholas PD, Hanner RH (2023) VLF: An R package for the analysis of very low frequency variants in DNA sequences. Biodiversity Data Journal 11: e96480. https://doi.org/10.3897/BDJ.11.e96480
No full textVLF analysis R scrip
Supplementary material 1 from: Borisenko A, Young R, Hanner R (2024) A lab-centric, workflow-based data management system for environmental DNA research. Research Ideas and Outcomes 10: e120483. https://doi.org/10.3897/rio.10.e120483
No full texteDNA Laboratory Database Schema Outlin
Auditory Discrimination and Phonetic Contexts in School Age Children
No full textNo abstract provided by author
A detailed study of the reflection nebula, NGC 7023
No full textPolarisation and intensity maps in three broad wavebands are presented for the reflection nebula NGC7023. The data are used to investigate the structure, dust distribution and grain characteristics of the material surrounding the central illuminating star HD200775 of the reflection nebula. Calculations have been made, using a Monte-Carlo technique, for various parameters representing the structure and content of the nebula to predict and explain the observed measurements. The successful description of the observations puts severe restrictions on the nebular parameters. It is found that the geometry of the nebula is in the form of an extended cloud with a foreground conical cavity in which the illuminating star is situated. The dust grains are required to have a power law size distribution of the form n(a) = a(^4.05) and grain material corresponding to silicates is most likely although ice cannot be excluded
El desbordamiento de la acción de tutela: Reflejo de desconocimiento de la autonomía colombiana
No full textEl ensayo analiza el uso excesivo de la acción de tutela en Colombia, planteando que su desbordamiento refleja el desconocimiento ciudadano y las fallas del sistema judicial ordinario. La tutela, concebida como mecanismo subsidiario para proteger derechos fundamentales, ha sido usada como vía principal, saturando los despachos judiciales y debilitando su eficacia. El texto identifica causas como la falta de educación jurídica y la inoperancia de mecanismos judiciales ordinarios. Además, advierte sobre impactos a corto, mediano y largo plazo, y cuestiona su uso como “tercera instancia”. Propone recuperar su carácter excepcional mediante pedagogía jurídica y fortalecimiento institucional.PregradoDerech
Recruiting older people to a randomised controlled dietary intervention trial - how hard can it be?
No full textBackground: The success of a human intervention trial depends upon the ability to recruit eligible volunteers. Many trials fail because of unrealistic recruitment targets and flawed recruitment strategies. In order to predict recruitment rates accurately, researchers need information on the relative success of various recruitment strategies. Few published trials include such information and the number of participants screened or approached is not always cited.
Methods: This paper will describe in detail the recruitment strategies employed to identify older adults for recruitment to a 6-month randomised controlled dietary intervention trial which aimed to explore the relationship between diet and immune function (The FIT study). The number of people approached and recruited, and the reasons for exclusion, will be discussed.
Results: Two hundred and seventeen participants were recruited to the trial. A total of 7,482 letters were sent to potential recruits using names and addresses that had been supplied by local Family (General) Practices. Eight hundred and forty three potential recruits replied to all methods of recruitment (528 from GP letters and 315 from other methods). The eligibility of those who replied was determined using a screening telephone interview, 217 of whom were found to be suitable and agreed to take part in the study.
Conclusion: The study demonstrates the application of multiple recruitment methods to successfully recruit older people to a randomised controlled trial. The most successful recruitment method was by contacting potential recruits by letter on NHS headed note paper using contacts provided from General Practices. Ninety percent of recruitment was achieved using this method. Adequate recruitment is fundamental to the success of a research project, and appropriate strategies must therefore be adopted in order to identify eligible individuals and achieve recruitment targets
Vingelengde som prediktor for kroppsstørrelse hos granmeis
No full textIn a subalpine mixed forest in central Norway, I measured the wing length, tail length and tarsus length and recorded the body mass of 48 male and 43 female first-year Willow Tits Poecile montanus. Some of these were retrapped in the following years and measured again after they had moulted. The wing length of first-year birds was significantly correlated (Pearson) with tail length (males: p<0.01; females: p<0.05) and tarsus length (males: p<0.05; females: p<0.05) but not with body mass. After their postnuptial moult in July-September, i.e. from their first-year to adult stage, the mean wing length of males increased significantly: 0.82 mm from their first to their second year and 0.37 mm from their second to their third year. Also the mean wing length increase in females was marked from first to second year (0.24 mm), but not for the following years. In adult Willow Tits, i.e. two years or older, the wing length was significantly correlated with only tarsus length (p<0.05) in males and tail length (p=0.01) in females. Thus, while wing length apparently is an appropriate measure of body size of first-year Willow Tits, it seems to give an uncertain reflection of the size in adult birds.Vingelengde, stjertlengde og tarslengde samt kroppsvekt ble registrert hos 48 hanner og 43 hunner av juvenile (1K) granmeis i felt. Flere av disse ble gjenfanget og målt i de følgende tre årene. Vingelengden hos hanner økte gjennomsnittlig 0.82 mm fra første til andre år og 0.37 mm fra andre til tredje år. Hos hunner var økningen fra første til andre år 0.24 mm. Vingelengden hos juvenile hanner og hunner var klart korrelert med stjert- og tarslengde, men ikke med kroppsvekten. Hos adulte (to år eller eldre) var vingelengden korrelert bare med tarslengden hos hanner og stjertlengden hos hunner. Vingelengden synes derfor å være en god prediktor for kroppsstørrelse hos juvenile granmeiser, mens den er mindre sikker for adulte
Cometary dust in astrophysics
No full textThe purpose of the meeting was the integration of astrophysical observations of comets and interstellar/circumstellar dust with laboratory analyses of interplanetary dust particles, stardust, and meteorites, and to discuss what we hope to learn from comet samples to be returned by Stardust in 2006.University of Washington, Lunar and Planetary Institute, NASA Johnson Space Centermeeting organizers, Don E. Brownlee, Lindsay P. Keller, Scott R. Messenger ; scientific organizing committee, Don E. Brownlee [and others] ; compiled ... by Lunar and Planetary InstitutePARTIAL CONTENTS: A participating scientist for the stardust mission / T.H. Morgan and B.G. Geldazhler--Circumstellar grains in meteorites and IDPs: isotopic connections between stellar generations / L.R. Nittler--The nature of interstellar dust / G.R. Huss--Infrared spectroscopy of the dust in comets and relationships to interstellar dust / Martha S. Hanner
- …
