1,721,021 research outputs found
Giraffa tippelskirchi subsp. tippelskirchi tippelskirchi Matschie 1898
No full textGiraffa tippelskirchi tippelskirchi Matschie, 1898 Giraffa schillingsi Matschie, 1898: 79. Diagnosis Stellate formed spots, shanks olive-coloured and spotted down to the hoofs, anterior horn less developed, one ES in the Cytb gene: 1033 C=>T. Distribution Southern Kenya, Tanzania.Published as part of Petzold, Alice, Magnant, Anne-Sophie, Edderai, David, Chardonnet, Bertrand, Rigoulet, Jacques, Saint-Jalme, Michel & Hassanin, Alexandre, 2020, First insights into past biodiversity of giraffes based on mitochondrial sequences from museum specimens, pp. 1-33 in European Journal of Taxonomy 703 on page 24, DOI: 10.5852/ejt.2020.703, http://zenodo.org/record/398966
FIGURE 7 in Disentangling the Pelomedusa complex using type specimens and historical DNA (Testudines: Pelomedusidae)
No full textFIGURE 7. Dorsal and ventral views of the lectotype of Pelomedusa galeata damarensis Hewitt, 1935 (PEM R14953, adult male, straight carapacial length 14.0 cm; top) and of the holotype of Pelomedusa galeata devilliersi Hewitt, 1935 (PEM R14962, adult female, straight carapacial length 19.24 cm; bottom). Scale bars, 3 cm. Photos: W.R. Branch.Published as part of Fritz, Uwe, Petzold, Alice, Kehlmaier, Christian, Kindler, Carolin, Campbell, Patrick, Hofmeyr, Margaretha D. & Branch, William R., 2014, Disentangling the Pelomedusa complex using type specimens and historical DNA (Testudines: Pelomedusidae), pp. 501-522 in Zootaxa 3795 (5) on page 517, DOI: 10.11646/zootaxa.3795.5.1, http://zenodo.org/record/491506
Giraffa giraffa subsp. giraffa giraffa giraffa (Boddaert 1784
No full textGiraffa giraffa giraffa (Boddaert, 1784) Camelopardalis australis Swainson, 1835: 284. Camelopardalis capensis Lesson, 1842: 168. Camelopardalis maculata Weinland, 1863: 205, fig. p. 206. Giraffa camelopardalis angolensis Lydekker, 1903: 121, fig. p. 121. Diagnosis One ES in the Cytb gene: 798 T=>C; two ES in the CR: 130 iT, 170 A=>G. Distribution Angola, Botswana, Namibia, Zimbabwe.Published as part of Petzold, Alice, Magnant, Anne-Sophie, Edderai, David, Chardonnet, Bertrand, Rigoulet, Jacques, Saint-Jalme, Michel & Hassanin, Alexandre, 2020, First insights into past biodiversity of giraffes based on mitochondrial sequences from museum specimens, pp. 1-33 in European Journal of Taxonomy 703 on page 25, DOI: 10.5852/ejt.2020.703, http://zenodo.org/record/398966
Giraffa tippelskirchi subsp. thornicrofti Lydekker 1911
No full textGiraffa tippelskirchi thornicrofti Lydekker, 1911 Diagnosis Low and conical anterior horn, grey colour and scattered spotting of the sides of the face, fawn shanks, three ES in the CR: 39 A=>G, 272 T=>C, 336 T=>A; two ES in the IGF2B1 intron: 60 C=>T, 304 G =>A. Type material Holotype ZAMBIA • 1 specimen (skin); Petauke district; NHMUK-1910.10.17.1. Distribution Luangwa Valley in Zambia.Published as part of Petzold, Alice, Magnant, Anne-Sophie, Edderai, David, Chardonnet, Bertrand, Rigoulet, Jacques, Saint-Jalme, Michel & Hassanin, Alexandre, 2020, First insights into past biodiversity of giraffes based on mitochondrial sequences from museum specimens, pp. 1-33 in European Journal of Taxonomy 703 on page 25, DOI: 10.5852/ejt.2020.703, http://zenodo.org/record/398966
Giraffa tippelskirchi Matschie 1898
No full textGiraffa tippelskirchi Matschie, 1898 Diagnosis Faint or strongly stellate form of the patches, absence of occipital horns, seven ES in the UBN2 intron: 48 dA, 209 iCATAATATATTTAATATATTTAATATTTAATAA, 243 T=>A, 318 G =>C, 332 T=>G, 504 A=> C, 623 C=>T Type material Lectotype (here designated) TANZANIA • 1 specimen (skull and skin); Lake Eyasi; ZMB-084951. Distribution Kenya, Tanzania (lectotype), Zambia. Remarks Matschie (1898) mentions two different specimens as syntypes, but the second cannot be found in the collection catalogue and might be considered as lost.Published as part of Petzold, Alice, Magnant, Anne-Sophie, Edderai, David, Chardonnet, Bertrand, Rigoulet, Jacques, Saint-Jalme, Michel & Hassanin, Alexandre, 2020, First insights into past biodiversity of giraffes based on mitochondrial sequences from museum specimens, pp. 1-33 in European Journal of Taxonomy 703 on page 24, DOI: 10.5852/ejt.2020.703, http://zenodo.org/record/398966
Fig. 5 in First insights into past biodiversity of giraffes based on mitochondrial sequences from museum specimens
No full textFig. 5. Giraffe subspecies of the Nile region. The map (extracted from Google Earth; https://www.google.com/intl/de/earth/) shows the geographical barriers (rivers and mountains) that may have isolated (at least temporarily) the subspecies Giraffa camelopardalis camelopardalis (Linnaeus, 1758) (red), G. c. antiquorum (Jardine, 1835) (yellow), G. c. rothschildi Lydekker, 1903 (green) and G. c. reticulata de Winton, 1899 (magenta). The question mark refers to the uncertain geographic origin of Zarafa (left) and the two specimens from Abyssinia (right) (see Discussion for more details).Published as part of Petzold, Alice, Magnant, Anne-Sophie, Edderai, David, Chardonnet, Bertrand, Rigoulet, Jacques, Saint-Jalme, Michel & Hassanin, Alexandre, 2020, First insights into past biodiversity of giraffes based on mitochondrial sequences from museum specimens, pp. 1-33 in European Journal of Taxonomy 703 on page 18, DOI: 10.5852/ejt.2020.703, http://zenodo.org/record/398966
Giraffa camelopardalis subsp. camelopardalis camelopardalis (Linnaeus 1758
No full textGiraffa camelopardalis camelopardalis (Linnaeus, 1758) Camelopardalis aethiopicus Ogilby, 1837: 134. Camelopardalis biturigum Duvernoy, 1844: 12, fig. 4. Giraffa camelopardalis typica Bryden, 1899: 489, plate XIV. Diagnosis Front of the face sparsely and sides fully spotted, similar pattern to reticulata but with chestnut or sandy patches. Past distribution Probably extinct, former range between the Blue Nile and Tekezé /Atbara rivers in southeastern Sudan (eastern Sennar) and northern Ethiopia (Abyssinia).Published as part of Petzold, Alice, Magnant, Anne-Sophie, Edderai, David, Chardonnet, Bertrand, Rigoulet, Jacques, Saint-Jalme, Michel & Hassanin, Alexandre, 2020, First insights into past biodiversity of giraffes based on mitochondrial sequences from museum specimens, pp. 1-33 in European Journal of Taxonomy 703 on page 22, DOI: 10.5852/ejt.2020.703, http://zenodo.org/record/398966
Giraffa camelopardalis subsp. senegalensis Petzold, Magnant & Hassanin 2020, subsp. nov.
No full textGiraffa camelopardalis senegalensis Petzold, Magnant & Hassanin, subsp. nov. urn:lsid:zoobank.org:act: 838C1DB1-59BA-49DD-B5AA-F5432F36B112 Diagnosis Beige ground colour covered with dark brown spots following a reticulated pattern separated by narrow lines, skull features detailed in Blainville (1864), one ES in the Cytb gene: 732 A=> G; four ES in the CR: 92 dC, 95 A=>G, 359 C =>T, 463 A=>G. Type material examined Holotype (here designated) SENEGAL • 1 specimen (skeleton); Bakel; MNHN-A10617. Past distribution Probably extinct, former range extended over Senegal (holotype) and potentially Gambia, Mauritania and Mali.Published as part of Petzold, Alice, Magnant, Anne-Sophie, Edderai, David, Chardonnet, Bertrand, Rigoulet, Jacques, Saint-Jalme, Michel & Hassanin, Alexandre, 2020, First insights into past biodiversity of giraffes based on mitochondrial sequences from museum specimens, pp. 1-33 in European Journal of Taxonomy 703 on page 24, DOI: 10.5852/ejt.2020.703, http://zenodo.org/record/398966
Giraffa camelopardalis subsp. reticulata de Winton 1899
No full textGiraffa camelopardalis reticulata de Winton, 1899 Giraffa camelopardalis australis Rhoads, 1896: 518. Giraffa hagenbecki Knottnerus-Meyer, 1910: 800. Giraffa reticulata nigrescens Lydekker, 1911: 484. Diagnosis Deep liver-red colour with a coarse network of narrow white lines, one ES in the Cytb gene: 795 C=>T; one ES in the CR: 94 C=>T. Type material Holotype KENYA • 1 specimen (skull, scalp and piece of neck skin); East of Loroghi mountains; NHMUK-1897.1.30.1. Distribution Southern Ethiopia, Kenya (holotype), Somalia.Published as part of Petzold, Alice, Magnant, Anne-Sophie, Edderai, David, Chardonnet, Bertrand, Rigoulet, Jacques, Saint-Jalme, Michel & Hassanin, Alexandre, 2020, First insights into past biodiversity of giraffes based on mitochondrial sequences from museum specimens, pp. 1-33 in European Journal of Taxonomy 703 on page 23, DOI: 10.5852/ejt.2020.703, http://zenodo.org/record/398966
Giraffa camelopardalis subsp. rothschildi Lydekker 1903
No full textGiraffa camelopardalis rothschildi Lydekker, 1903 Diagnosis Lower parts of the legs pure white and unspotted, spots show a tendency to split up into stars, occipital pair of ossicones, one ES in the CR: 129 T=> C. Type material Holotype KENYA • 1 specimen (mounted skin); Guasin-gisha Plateau east of Mount Elgon; NHMUK-1903.4.15.1. Distribution Western Ethiopia, Kenya (holotype), Uganda, South Sudan.Published as part of Petzold, Alice, Magnant, Anne-Sophie, Edderai, David, Chardonnet, Bertrand, Rigoulet, Jacques, Saint-Jalme, Michel & Hassanin, Alexandre, 2020, First insights into past biodiversity of giraffes based on mitochondrial sequences from museum specimens, pp. 1-33 in European Journal of Taxonomy 703 on page 23, DOI: 10.5852/ejt.2020.703, http://zenodo.org/record/398966
- …
