1,735,650 research outputs found

    MBP-RhlR:mBTL and MBP-RhlR* bind equally well to DNA.

    No full text
    A) Electrophoretic mobility gel shifts showing 300 bp biotin-labeled DNA fragments containing the rhlA (top), rhlI (center), and hcnA (bottom) promoters incubated with different concentrations of MBP-RhlR:mBTL or MBP-RhlR*. “Ub” and “B” denote unbound DNA and DNA bound to protein, respectively. The probe DNA was used at 30 ng with 500, 200, 100, 50, 30, 20, and 10 ng of the specified protein going from left to right on the gels. The right-most lane shows the no protein control (designated by the dash). B) Isothermal titration calorimetry analyses of MBP-RhlR:mBTL (top) and MBP-RhlR* (bottom) binding to the rhl-box consensus DNA sequence (ACCTGCCAGATTTCGCAGGT). 1 μM protein and 20 μM DNA were used in the reactions. The calculated Kd values for MBP-RhlR:mBTL and for MBP-RhlR* for the rhl-box consensus sequence are 23 nM and 34 nM, respectively. DP and ΔH denote differential power and enthalpy, respectively.</p

    Myelin basic protein peptide 45–89 induces the release of nitric oxide from microglial cells.

    Get PDF
    Continuous (24 h) exposure of mixed oligodendrocyte/microglial cells to peptides 45–89 derived from citrullinated C8 isoforms of myelin basic protein (MBP) induces cell death. In contrast, MBP-C8 at the same molecular concentration is not toxic to oligodendrocyte/microglial cells as detected by the MTT test and trypan blue exclusion method. The loss of oligodendrocyte/microglial cells resulted in the release of cytochrome c from mitochondria, suggesting MBP 45–89-induced apoptosis. On the other hand, peptides 45–89 stimulated the secretion of nitric oxide from microglial cells only via induction of iNOS. The addition of peptide 45–89 to the microglial cells led to a decrease of the level of the inhibitory protein IkB, indicating that activation of the transcription factor NF-kB is involved in these processes. We propose that the immunodominant peptide 45–89 induces damage of oligodendrocytes by activation of microglial cells and subsequent generation of nitric oxide, and that this may be the first step in the initiation of autoimmunity

    SDS-PAGE analyses of 8xHis-StrepII-MBP-3607 purification (A) and tobacco etch virus (TEV) protease cleavage (B).

    No full text
    Lanes: M, molecular mass markers; Lane 1, pellet material after lysate clarification; Lane 2, soluble lysate; Lane 3, StrepTrap column flowthrough; Lane 4, protein washed from column; Lanes 5–11, protein elution fractions; Lane 12, pooled elution fractions; Lane 13; protein after digestion with TEV protease. The expected molecular masses of 8xHis-StrepII-MBP-3607, tag-free 3607 protein, and MBP are 100, 56, and 44 kDa, respectively.</p

    Data on Soil MBC-MBP-MS# 14-0189R1-EA-2014-08-10

    No full text
    Properties of soil chemistry on microbial biomass in the experimental paddy field after 7 years of phosphorus application, including the following microbial biomass carbon (MBC) and microbial biomass phosphorus (MBP

    MBP-Pro45-70-His6 inhibits MSTN activity at much lower concentration than those required to inhibit GDF11 or Activin A activities.

    No full text
    Various concentrations (20, 6.67, 2.22, and 0.73 nM) of MBP-Pro45-70-His6 in combination with 1 nM MSTN, GDF11, or Activin A in serum-free DMEM were added to the HEK293 cells stably expressing (CAGA)12-luciferase gene construct, followed by incubation for 24 h. Luciferase activity was measured using Bright-Glo luciferase assay system (Promega, USA). The error bars indicate standard deviation (n = 3). Percentage of inhibition capacity = (luminescence at ligands (1 nM MSTN, GDF11, or Activin A)–luminescence at each MBP-Pro45-70-His6 concentration) × 100/(luminescence at ligands (1 nM MSTN, GDF11, or Activin A)–luminescence at 0 nM ligands. IC50 (ligand concentration inhibiting 50% of MSTN, GDF11 or Activin A activity) values were estimated by a non-linear regression model defining the dose-response curve. IC50 values not sharing the same superscript are different at P<0.01.</p

    Structural analysis of MBP-fused and MBP-cleaved STs.

    No full text
    A) SDS-PAGE of MBP-fused and MBP-cleaved STs. IMAC1: purification of full length fusion proteins; IMAC2: purification of MBP-cleaved STs after incubation with Factor Xa protease. B) SEC profile of IMAC purified MBP-hST3Gal1-5x and MBP-cleaved hST3Gal1-wild type and -5x variant. Dextran blue indicating the void volume and MBP are also shown. C) Circular dichroism spectra of MBP, MBP-STs and MBP-cleaved STs. D) Tertiary structure of hST6Gal1 (blue, PDB: 4js1)[18], pST3Gal1 (white, PDB: 2wnb)[16] and hST3Gal1 (model based on PDB 2wnb). SDS-PAGE image is composed of 3 gels, which is indicated by vertical black lines.</p

    MBP-Pro45-70-His6 blocks MSTN-induced Smad2/3 phosphorylation in HepG2 cell.

    No full text
    HepG2 cells were cultured in serum-free DMEM for 4 h, followed by treatment with the combination of 10 nM MSTN, 10 μM SB431542, or 600 nM MBP-Pro45-70-His6 for 30 min. The blots are representative of three independent assays and have been sequentially probed with antibodies against phospho-Smad2 (p-Smad2) or phospho-Smad3 (p-Smad3), total Smad2 (Smad2) or total Smad3 (Smad3), and b-actin. Densitometry analyses of the blots were from three independent assays. The Relative phosphorylation levels of p-Smad2 and p-Smad3 were normalized by the expression level of total Smad2 (A) or total Smad3 (B), respectively. The error bars indicate standard deviation (n = 3). Different letters are significantly different at P<0.05.</p

    In vitro binding assays between the pmalc2 empty vector (MBP), full-length pmalc2-MoMLV IN (mIN) or full-length pmalc2-HIV-1 IN (hIN) and seventeen of the clones isolated in the screen, plus mLEDGF expressed as GST fusions

    No full text
    The MBP fusion lysates were incubated with amylose resin, washed extensively, resuspended in equal volumes of buffer, and then aliquoted to separate tubes. These tubes were incubated with the GST fusion lysates, washed and eluted with 15 mM maltose. 25 μl of each eluate was electrophoresed on 10 or 12% SDS-PSGE gels, transferred to PVDF membranes, and the same Western was probed with anti-GST, stripped, and then probed with anti-MBP. All Westerns are loaded from left to right: MBP, mIN, and hIN fusion reactions. All upper panels, anti-MBP. All lower panels, anti-GST. Maltose binding protein fusions with empty GST vector; MBP fusions with Brd2, AF9, and Ankrd49. MBP fusions with mLEDGF, Fen-1, Enx-1, and TFIIE-β. MBP fusions with Ku70, PRC, Baz2b, and ABT1. MBP fusions with SF3a3, U5snRNP, KIF3A, and Radixin. MBP fusions with Znfp38, U2AF, and Ran bp10.<p><b>Copyright information:</b></p><p>Taken from "Host proteins interacting with the Moloney murine leukemia virus integrase: Multiple transcriptional regulators and chromatin binding factors"</p><p>http://www.retrovirology.com/content/5/1/48</p><p>Retrovirology 2008;5():48-48.</p><p>Published online 13 Jun 2008</p><p>PMCID:PMC2481268.</p><p></p

    Impact of a mindfulness-based program (MBP) on paediatric intensive care staff wellbeing

    No full text
    Introduction: Whilst intensive care staff are required to function effectively and efficiently to achieve optimal patient outcomes, they themselves are at risk of stress and burnout due to the nature of the work. Stress has been detrimentally linked to mental health, physiological conditions, satisfaction, tenure, and patient care. Self-reflection and self-care strategies can buffer stress; however, a key challenge is identifying feasible pathways to deliver such programs in the intensive care environment. Accordingly, we developed, delivered and evaluated a MBP program. Objectives: This study examined feasibility, impact, and staff perceptions towards MBP and explored the difference in various domains of Work Environment Scale (WES) and Warwick Edinburgh Mental Wellbeing Scale (WEMWBS) pre-post the MBP delivery. Methods: MBP involved 20-minute guided practice every Wednesday facilitated by a trained facilitator. The facilitators used mindful breathing, body scan meditation and simple yoga stretches. A pre and a post-MBP survey conducted. The voluntary survey included demographics, attitude, knowledge of mindfulness practices, WES and WEMWBS. Results: Four-hundred twenty-three participants responded to the survey at either pre (n=208) or post (n=215) implementation stage. Eighty percent (n=340) of the participants were females; 73% participants were under 45 years old and 67% belonged to nursing stream. Median work experience of survey participants was 9 years (IQR 11 y). The proportion of participants practising mindfulness increased after MBP (p=0.02). There was no difference in self-realisation, nervousness, conflict, workload and overall WEMWBS pre-post MBP. Conclusion: Mindfulness group practice was feasible in a busy tertiary PICU. While proportion of participants practicing mindfulness increased, this was not mirrored in the assessment scores. A longer duration of exposure is required to assess sustainability and longer-term impact.No Full Tex

    Trimerization of MBP-CC.

    No full text
    <p>(A,B) Crystal structure of the MBP-CC asymmetric unit, with each protomer colored differently. Maltose-binding protein is shown as a C<sub>α</sub>-trace, and the xMcm10 coiled-coil is depicted as a cartoon ribbon. (C,D) Sedimentation velocity profiles of MBP-CC<sup>95–132</sup> (C) and free MBP (D) at pH 4.7. Molecular masses (kDa) calculated from the sedimentation data are shown above each peak. The molecular mass of a single polypeptide calculated from the amino acid composition are 45.1 kDa (MBP-CC) and 40.4 kDa (MBP).</p
    corecore