90,456 research outputs found

    Lysmata bahia Rhyne & Lin 2006

    No full text
    <i>Lysmata bahia</i> Rhyne & Lin, 2006 <p> <i>Lysmata bahia</i> Rhyne & Lin, 2006: 191, figs. 16–18, pl. 1F.</p> <p> <b>Material examined.</b> None.</p> <p> <b>Distribution.</b> Western Atlantic—Panama and Brazil (Ceará, Sergipe, Bahia, Rio de Janeiro, São Paulo) (Rhyne & Lin 2006; Baeza 2008; Barros-Alves <i>et al</i>. 2015; Pachelle <i>et al</i>. 2016).</p> <p> <b>Previous records.</b> Santos Harbor (paratypes collected in 1950 and deposited at USNM) (Rhyne & Lin 2006).</p>Published as part of <i>Terossi, Mariana, Almeida, Alexandre O., Buranelli, Raquel C., Castilho, Antonio L., Costa, Rogério C., Zara, Fernando J. & Mantelatto, Fernando L., 2018, Checklist of decapods (Crustacea) from the coast of the São Paulo state (Brazil) supported by integrative molecular and morphological data: I. Infraorder Caridea: families Hippolytidae, Lysmatidae, Ogyrididae, Processidae and Thoridae in Zootaxa 4370 (1)</i>, DOI: 10.11646/zootaxa.4370.1.6, <a href="http://zenodo.org/record/1138546">http://zenodo.org/record/1138546</a&gt

    Liphistius liz Lin & Li 2023, sp. nov.

    No full text
    <p>Liphistius liz Lin & Li, 2023 sp. nov.</p> <p>Materials</p> <p> <b>Type status:</b> Holotype. <b>Occurrence:</b> catalogNumber: IZCAS-Ar44748; recordedBy: Yicheng Lin; individualCount: 1; sex: male; lifeStage: adult; occurrenceID: 5BCC41FF-4DC2-53C5-836F-F9BBC80D4BDE; <b>Taxon:</b> scientificName: Liphistius liz; <b>Location:</b> country: China; stateProvince: Yunnan; county: Lianghe; locality: Jiubao Achang Township, Shizunao; verbatimElevation: 1200 m; decimalLatitude: 24.7478; decimalLongitude: 98.2106; <b>Identification:</b> identifiedBy: Yejie Lin; dateIdentified: 2023; <b>Event:</b> year: 2023; month: 5; day: 13 <b>Type status:</b> Paratype. <b>Occurrence:</b> catalogNumber: IZCAS-Ar44749; recordedBy: Yicheng Lin; individualCount: 1; sex: female; lifeStage: adult; occurrenceID: 2177DB32-CFCD-5FED-9AAF-D1629797C869; <b>Taxon:</b> scientificName: Liphistius liz; <b>Location:</b> country: China; stateProvince: Yunnan; county: Lianghe; locality: Jiubao Achang Township, Shizunao; verbatimElevation: 1200 m; decimalLatitude: 24.7478; decimalLongitude: 98.2106; <b>Identification:</b> identifiedBy: Yejie Lin; dateIdentified: 2023; <b>Event:</b> year: 2023; month: 8; day: 12 <b>Type status:</b> Paratype. <b>Occurrence:</b> catalogNumber: IZCAS-Ar44750; recordedBy: Yicheng Lin; individualCount: 1; sex: female; lifeStage: adult; occurrenceID: 4FEE7ED6-6BCF-50BB-A7A5-D3C318237341; <b>Taxon:</b> scientificName: Liphistius liz; <b>Location:</b> country: China; stateProvince: Yunnan; county: Lianghe; locality: Jiubao Achang Township, Shizunao; verbatimElevation: 1200 m; decimalLatitude: 24.7478; decimalLongitude: 98.2106; <b>Identification:</b> identifiedBy: Yejie Lin; dateIdentified: 2023; <b>Event:</b> year: 2023; month: 8; day: 12 <b>Type status:</b> Paratype. <b>Occurrence:</b> catalogNumber: IZCAS-Ar44751; recordedBy: Yicheng Lin; individualCount: 1; sex: female; lifeStage: adult; occurrenceID: 34FCBAD1-1985-59EA-8784-A3605859BC42; <b>Taxon:</b> scientificName: Liphistius liz; <b>Location:</b> country: China; stateProvince: Yunnan; county: Lianghe; locality: Jiubao Achang Township, Shizunao; verbatimElevation: 1200 m; decimalLatitude: 24.7478; decimalLongitude: 98.2106; <b>Identification:</b> identifiedBy: Yejie Lin; dateIdentified: 2023; <b>Event:</b> year: 2023; month: 8; day: 12 <b>Type status:</b> Paratype. <b>Occurrence:</b> catalogNumber: IZCAS-Ar44752; recordedBy: Yicheng Lin; individualCount: 1; sex: female; lifeStage: adult; occurrenceID: BB3338CB-0A61-516F-BEA2-1CA2A06BA8E9; <b>Taxon:</b> scientificName: Liphistius liz; <b>Location:</b> country: China; stateProvince: Yunnan; county: Lianghe; locality: Jiubao Achang Township, Shizunao; verbatimElevation: 1200 m; decimalLatitude: 24.7478; decimalLongitude: 98.2106; <b>Identification:</b> identifiedBy: Yejie Lin; dateIdentified: 2023; <b>Event:</b> year: 2023; month: 8; day: 12</p> <p>Description</p> <p>Male (holotype, Figs 2, 3 b, 4, 7 A). Total length 7.55. Carapace 4.19 long and 3.83 wide, earthy yellow in ethanol (slightly lighter than in life), margin and fovea colour darker, without obvious dark stripes between coxal elevations (Fig. 7 A). Eye sizes and interdistances: AME 0.06, ALE 0.49, PME 0.25, PLE 0.35, AME-AME 0.08, AME-ALE 0.08, PME-PME 0.04, PME-PLE 0.06, AME-PME 0.02, ALE-PLE 0.05. Chelicerae reduced, brown, with several short macrosetae. Labium 0.73 long and 0.44 wide, fused with sternum. Sternum 1.98 long and 0.75 wide, posterior tip elongated. Opisthosoma 3.54 long and 2.29 wide, with ten tergites. Leg measurements: leg I 11.86 (3.26, 3.85, 3.17, 1.58), leg II 13.46 (3.83, 4.07, 3.51, 2.05), leg III 14.88 (3.53, 4.30, 4.47, 2.58), leg IV 19.41 (4.69, 5.51, 5.91, 3.30).</p> <p>Palp (Figs 2, 3 b, 4). Tibial apophysis of palp almost as high as wide, situated near retrolateral margin of tibia, with four megaspines. Cymbium with two clavate trichobothria retrolaterally (Fig. 4 D). Paracymbium large and thick, almost as wide as cymbium, cumulus distinctly elevated with many long setae (Fig. 4). Subtegulum curved in prolaterodorsal and ventral views, without obvious apophysis. Tegulum with a well-developed and denticulate distal edge. Half of the contrategulum strongly sclerotised, with a ventral process (Figs 2, 3 b). Paraembolic plate slightly elevated. Embolus partly sclerotised, with some longitudinal ridges extending to the tip, margins of these ridges slightly dentated (Figs 2, 3 b).</p> <p>Female (paratype, Figs 1, 5, 7 B). Total length 10.32. Carapace 4.87 long, 4.16 wide, colour as in males, except shades being darker (Figs 1, 7 B). Eye sizes and interdistances: AME 0.06, ALE 0.45, PME 0.27, PLE 0.31, AME-AME 0.06, AME-ALE 0.07, PME-PME 0.04, PME-PLE 0.05, AME-PME 0.04, ALE-PLE 0.05. Chelicerae robust, reddish-brown, with a few short stripes on dorsal side and several long macrosetae on retrolateral edge of fang groove. Labium 1.03 long, 0.52 wide. Sternum 242 long, 1.23 wide. Opisthosoma 5.92 long, 4.52 wide, with ten tergites. Leg measurements: leg I 8.60 (3.04, 2.77, 1.75, 1.04), leg II 8.63 (2.68, 3.16, 1.65, 1.14), leg III 9.80 (2.98, 3.14, 2.28, 1.48), leg IV 14.34 (3.93, 4.47, 3.83, 2.11).</p> <p>Vulva (Fig. 5): Poreplate with four notobvious protuberances (two anterolateral and two posterolateral), two posterolateral protuberances not attached to ventral rim of poreplate. Central dorsal opening globular, receptacular cluster grape-shaped. Bulging margins on ventral poreplate only extending to the posterolateral corner of poreplate (Fig. 5 B) and distance between bulging margins almost as wide as poreplate. Genital atrium straight. Posterior area of posterior stalk located in the same plane of poreplate and almost as wide as poreplate (Fig. 5 A).</p> <p>Diagnosis</p> <p> Males of the new species resemble <i>Liphistius nabang</i> Yu, Zhang & Zhang, 2021 by the general shape of the embolus and tegulum with a clearly outlined distal edge (Fig. 3) and similar body colouration (Fig. 7) and the female with a similar-shaped poreplate plate. However, <i>L. liz</i> sp. nov. can be distinguished by the male with curved subtegulum (Fig. 2) [vs. subtegulum straight in <i>L. nabang</i> (see Yu et al. (2021), figs. 3A and B)] and tibial apophysis almost as high as wide (Fig. 4) [vs. wider than high in <i>L. nabang</i> (see Yu et al. (2021), figs. 3 D-F)]. Females of the new species can be distinguished from those of <i>L. nabang</i> by the straight genital atrium (Figs 5, 6) [vs. genital atrium curved in <i>L. nabang</i> (see Yu et al. (2021), fig. 4)], posterior stalk and poreplate are located in the same plane (Figs 5, 6) [vs. posterior stalk perpendicular to poreplate in <i>L. nabang</i> (see Yu et al. (2021), fig. 4)] and posterior stalk two times longer than wide [vs. posterior stalk four times longer than wide in <i>L. nabang</i> (see Yu et al. (2021), fig. 4)].</p> <p>Etymology</p> <p>The specific name refers to the short name for the Laboratory of Invertebrate Zoology (LIZ), Institute of Zoology, Chinese Academy of Sciences in Beijing; noun in apposition. LIZ was founded by Shen Jia-Rui (see Dai (1997)) in 1928, later led by Daxiang Song (see Marusik (2008)) from 1975 to 1995 and has been led by the senior author Shuqiang Li from 1995 to the present.</p> <p>Distribution</p> <p>China (Yunnan; Fig. 8).</p> <p>DNA barcode</p> <p>CTGCGATGGTTATATTCAACAAATCACAAAGATATTGGAACTATATATTTAATTTTTGGTGTATGATCTGCCATAATCGGAACTGCACTAAGATTATTAATTCGAGCAGAATTAGGTCAACCAGGAAGATTAATCGGAGACGATCAAACATATAATGTAATTGTAACAGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCTATAATAATTGGAGGTTTTGGAAATTGATTAATCCCTCTTATACTAAGAGCCCCTGATATAGCTTTTCCTCGATTAAATAATTTAAGATTTTGATTATTACCCCCCTCTATCACCCTCTTATTGATTTCATCCATAGTAGAAAGAGGCTCCGGCACAGGTTGGACTATTTATCCCCCTATTGCTAGCATAGAATTTCACCCTGGTATATCTATTGATTATACTATTTTTTCATTACACCTTGCCGGGGCCTCTTCAATCTTAGGCGCAATTAATTTTATTACCACTATTATTAACATACGACCAAGAGGTATATTAATAGAGCGAGTACCATTATTTGTTTGATCTATTCTTATTACCGCAAGCCTACTGTTACTATCTTTACCTGTATTAGCTGGTGCGATTACTATGCTATTAACAGATCGAAATTTTAACACGTCATTTTTTGATCCAGCAGGAGGTGGTGACCCTATCCTATTCCAACATTTATTTTGATTTTTTGGTCATCCAGAAGTTTACATTCTTATTATTCCAGGTTTTGGGATAATTTCACATATTGTAAGACACAACGCTGGAAAAAAAGAACCTTTTGGGTCTTTAGGCATAATTTATGCAATATCCGCTATTGGATTACTAGGGTTTGTAGTCTGAGCACACCATATATTTACAGTAGGTATAGATGTTGATACACGAGCTTATTTCACAGCAGCAACCATAATTATTGCAATCCCCACAGGAATTAAAATTTTTAGATGATTAGCTACTCTTCATGGTACTAATTTAATCATAAGTACTTCCCTAATATGGTCTATTGGATTTATCTTCCTATTCACTATTGGTGGATTAACAGGCGTAATCCTAGCTAATTCATCTATTGATATTGTTCTTCATGATACATACTATGTAGTAGCTCATTTTCATTATGTTTTATCAATAGGAGCAGTTTTTGCAATTATAGCAAGAATTATTCACTGATTCCCTTTATTTTTTGGATTTTCATTTAATCAAACTTTATTAAAAATTAACTTTTTTTCCATATTTATTGGTGTAAATATAACCTTTTTCCCACAACACTTCTTAGGATTAAATGGAATACCACGACGATATTCAGATTACCCTGATATATTTATATCATGAAATGTAATTTCATCTTTAGGAAGAATTTTATCTTTTCTAGCAGTAATTATATTTATTTTAATTGTATGAGAAAGAATTATATCGAACCGTAATATTTATATTCCTACTCAATCACCTTCTTCAGTTGAATGAACTCAAAATATTCCTCCTTCTAATCATACCTTTAATCAACTCAATATACTCATTTTCTAA (GenBank accession number OR721885).</p> <p>Compared material examined</p> <p> <i>Liphistius nabang</i>: Holotype: ♂ (MHBU-ARA-00020000), CHINA, Yunnan Province, Dehong Dai and Jingpo Autonomous Prefecture, Yingjiang County, Nabang Town, 24.7521°N, 97.563°E, 265 m elev., 2 August 2019, leg. Quanyu Ji.</p> <p>Variation</p> <p>Vulvae of two paratype females, see Fig. 6.</p>Published as part of <i>Lin, Yejie & Li, Shuqiang, 2023, A new species of Liphistius Schiodte, 1849 (Araneae, Liphistiidae) from Yunnan, China, pp. 113290 in Biodiversity Data Journal 11</i> on page 113290, DOI: 10.3897/BDJ.11.e11329

    <i>sdn-1</i> mutations enhance <i>lin-44</i> gastrulation defects.

    No full text
    <p>A: In <i>C</i>. <i>elegans</i>, gastrulation is initiated by the inward migration of the endodermal precursor cells Ea and Ep (black asterisks). In <i>sdn-1</i> and <i>ptp-3</i> mutant animals, the cells ingress, become completely surrounded by neighboring cells, then divide laterally (white asterisks). Note that Ea and Ep are completely internalized prior to the lateral cell division. In <i>lin-44</i> and <i>sdn-1</i> mutants, Ea/Ep ingression is often asynchronous. In addition, some <i>lin-44</i> embryos show a more severe phenotype, where the Ea/Ep cells completely fail to ingress. The subsequent lateral cell division positions two of the daughter cells onto the surface of the embryo, generating a “<u>G</u>ut on the <u>ex</u>terior”, or Gex phenotype [<a href="http://www.plosone.org/article/info:doi/10.1371/journal.pone.0121397#pone.0121397.ref077" target="_blank">77</a>]. Similar but more penetrant defects are observed in <i>lin-44; sdn-1</i> double mutants. B: Summary of Ea and Ep cell ingression behavior by genotype. The <i>lin-44; sdn-1</i> double mutants exhibit a higher rate of Ea and Ep ingression defects than either single mutant. C: Relative timing of developmental milestones as a function of genotype. Note the <i>lin-44; sdn-1</i> double mutants have a significantly longer period in which the gastrulation cleft is open.</p

    Latouchia wenruni Lin & Li 2023, sp. nov.

    No full text
    &lt;i&gt;Latouchia wenruni&lt;/i&gt; Lin &amp; Li, sp. nov. (Figs 9&ndash;10) &lt;p&gt;Etymology. The species is named after Mr. Run Wen, the collector of the holotype and paratypes; noun (name) in genitive case.&lt;/p&gt; &lt;p&gt; Diagnosis. The male of the new species is similar to that of &lt;i&gt;L. yuanjingae&lt;/i&gt; Lin &amp; Li, 2022 by the straight embolus and the length of embolus is as long as the bulb, but it can be distinguished by the serrated embolus in ventral view (&lt;i&gt;vs.&lt;/i&gt; smooth in &lt;i&gt;L. yuanjingae&lt;/i&gt;) and lacking bristles laterally on the tibia tip (&lt;i&gt;vs.&lt;/i&gt; present in &lt;i&gt;L. yuanjingae&lt;/i&gt;). The female of the new species can be distinguished from those of &lt;i&gt;L. yejiei&lt;/i&gt; Zhang &amp; Wang, 2021 by the prominent spermathecal heads (&lt;i&gt;vs.&lt;/i&gt; absent in &lt;i&gt;L. yejiei&lt;/i&gt;).&lt;/p&gt; &lt;p&gt;Description. Male (holotype). Total length 9.71; carapace 4.72 long, 4.16 wide, opisthosoma 4.99 long, 3.37 wide. Eye sizes and interdistances: AME 0.16, ALE 0.29, PME 0.21, PLE 0.28, AME&ndash;AME 0.07, AME&ndash;ALE 0.07, PME&ndash;PME 0.30, PME&ndash;PLE 0.02, AME&ndash;PME 0.09, ALE&ndash;PLE 0.09. Chelicerae with five promarginal and five retromarginal teeth. Leg measurements: I 14.18 (4.34, 5.08, 2.91, 1.85), II 12.59 (3.81, 4.16, 2.82, 1.80), III 10.52 (2.88, 3.05, 2.70, 1.89), IV 15.14 (4.16, 5.04, 3.85, 2.09).&lt;/p&gt; &lt;p&gt;Coloration (Fig. 10B). Carapace dark brown to brown, covered with black setae. Chelicerae dark brown. Endites and labium red-brown. Sternum yellow-brown. Legs brown with black setae. Opisthosoma oval, dark brown, dorsum with numerous irregular white spots, laterally brown, ventrum yellow-brown. Spinnerets short, yellow-brown.&lt;/p&gt; &lt;p&gt;Palp (Fig. 9). Tibia four times longer than wide, bristles on lateral side of tip are stout. Embolus slightly curved, tip with five serrations and an apophysis.&lt;/p&gt; &lt;p&gt;Female (IZCAS-Ar43840). Total length 18.23; carapace 8.54 long, 7.23 wide, opisthosoma 9.69 long, 6.61 wide. Eye sizes and interdistances: AME 0.26, ALE 0.43, PME 0.21, PLE 0.34, AME&ndash;AME 0.16, AME&ndash;ALE 0.22, PME&ndash;PME 0.58, PME&ndash;PLE 0.14, AME&ndash;PME 0.16, ALE&ndash;PLE 0.33. Chelicerae with six promarginal and eight retromarginal teeth. Leg measurements: I 18.64 (6.27, 7.39, 3.14, 1.84), II 15.28 (5.32, 5.57, 2.67, 1.72), III 14.22 (4.62, 5.23, 2.22, 2.15), IV 20.51 (6.29, 7.54, 4.19, 2.49).&lt;/p&gt; &lt;p&gt;Coloration (Fig. 10C). Similar to that of male except paler.&lt;/p&gt; &lt;p&gt;Endogyne (Fig. 10A). Spermathecae sock shaped, with numerous glandular pores; stalks almost as wide as spermatheca.&lt;/p&gt; &lt;p&gt;Material examined. Holotype &male; (IZCAS-Ar43837), China: Hainan, Changjiang Li Autonomous County, Bangxi Baomeiling (19.2815&deg;N, 109.0987&deg;E, elev. 603 m), 13 September 2022, Run Wen, Chengbin Wen and Neng Guo leg. Paratypes. 3&female; (IZCAS-Ar43838&ndash;Ar43840), same data as holotype.&lt;/p&gt; &lt;p&gt;Distribution. Known only from the type locality.&lt;/p&gt;Published as part of &lt;i&gt;Lin, Yejie, Li, Shuqiang &amp; Pham, Dinh-Sac, 2023, Taxonomic notes on some spider species (Arachnida: Araneae) from China and Vietnam, pp. 1-99 in Zoological Systematics 48 (1)&lt;/i&gt; on pages 12-13, DOI: 10.11865/zs.2023101, &lt;a href="http://zenodo.org/record/10941307"&gt;http://zenodo.org/record/10941307&lt;/a&gt

    Lysmata ankeri Rhyne & Lin 2006

    No full text
    Lysmata ankeri Rhyne & Lin, 2006 Lysmata ankeri Rhyne & Lin, 2006: 179, figs. 7–9, pl. 1C. Material examined. Brazil, São Paulo: 4 ind (3 ov), CCDB 3829, Ubatuba, off shore (35 m), coll. D. Rosa, 5– 14.ix.2011; 1 ind, CCDB 3831, Ubatuba, off shore (25–40 m), coll. D. Rosa, 15–17.viii.2011; 1 ind (1 ov), CCDB 3830, Ubatuba, off shore (30–40 m), coll. D. Rosa, 15–28.xi.2011; 1 ind, CCDB 4715, Ubatuba, Ilha das Couves, coll. D. Alves, 13.vi.2013; 1 ind, CCDB 1606, Santos, coll. A. Castilho et al., 24.x.2011. Distribution. Western Atlantic—USA (Florida), Haiti, Venezuela, Panama, Suriname, French Guyana, Brazil (Bahia to São Paulo) (Rhyne & Lin 2006; Alves et al. 2015; Barros-Alves et al. 2016). Previous records. Ubatuba, Couves Island (Alves et al. 2015; Barros-Alves et al. 2016). Remarks. DNA sequences matched with the sequences of L. ankeri used in the previous studies (Fiedler et al. 2010; Figure 3), confirming our morphological identification (see discussion section for more details). Sequences accession number (GenBank): CCDB 4715 - 16S (KU312981), COI (KU313010).Published as part of Terossi, Mariana, Almeida, Alexandre O., Buranelli, Raquel C., Castilho, Antonio L., Costa, Rogério C., Zara, Fernando J. & Mantelatto, Fernando L., 2018, Checklist of decapods (Crustacea) from the coast of the São Paulo state (Brazil) supported by integrative molecular and morphological data: I. Infraorder Caridea: families Hippolytidae, Lysmatidae, Ogyrididae, Processidae and Thoridae in Zootaxa 4370 (1), DOI: 10.11646/zootaxa.4370.1.6, http://zenodo.org/record/113854

    Asca hainanensis Ma & Lin 2008

    No full text
    &lt;p&gt; &lt;b&gt; &lt;i&gt;Asca hainanensis&lt;/i&gt; Ma &amp; Lin&lt;/b&gt; , &lt;b&gt;2008&lt;/b&gt;&lt;/p&gt; &lt;p&gt; &lt;i&gt;Asca hainanensis&lt;/i&gt; Ma &amp; Lin, in Ma &lt;i&gt;et al&lt;/i&gt;., 2008: 582. &lt;i&gt;Asca hainanensis&lt;/i&gt;.&mdash; Ma &amp; Lin, 2014: 21.&lt;/p&gt; &lt;p&gt;TYPE DEPOSITORY: Entomology Gallery, Institute of Microbiology and Epidemiology, Academy of Military Medical Sciences, Beijing, China.&lt;/p&gt; &lt;p&gt;TYPE LOCALITY AND HABITAT: Dongshanling, Wanning, Hainan, China, in leaf litter.&lt;/p&gt;Published as part of &lt;i&gt;De Moraes, Gilberto J., Britto, Erika P. J., Mineiro, Jefferson L. De C. &amp; Halliday, Bruce, 2016, Catalogue of the mite families Ascidae Voigts &amp; Oudemans, Blattisociidae Garman and Melicharidae Hirschmann (Acari: Mesostigmata), pp. 1-299 in Zootaxa 4112 (1)&lt;/i&gt; on page 95, DOI: 10.11646/zootaxa.4112.1.1, &lt;a href="http://zenodo.org/record/399477"&gt;http://zenodo.org/record/399477&lt;/a&gt

    <i>rab-7(ok511)</i> alters LET-23::GFP localization in the VPCs of <i>lin-2(-)</i> animals.

    No full text
    <p>(A-L) Single section confocal images of the VPCs (lateral view) of mid-L3 stage larvae following the first round of VPC division (Pn.px stage) immunostained with anti-GFP to detect LET-23::GFP (A, D, G and J) and the MH27 monoclonal antibody to detect the AJM-1 junctional protein (B, E, H, and K) demarcating the apical/basal boundry, and (C, F, I and L) are merged images with P6.pa and P6.pp cells underlined. (A–C) wild-type larva carrying <i>gaIs27(let-23::GFP)</i> showing LET-23::GFP in both the basal and apical regions of P6.pa and P6.pp cells. (D–F) <i>lin-2(e1309)</i>; <i>gaIs27(let-23::GFP)</i> larva with weak basal cytoplasmic and strong apical LET-23::GFP localization. (G–I) <i>rab-7(ok511)</i>; <i>gaIs27(let-23::GFP)</i> larva with basal cytoplasmic and apical LET-23::GFP expression in P6.pa and P6.pp with LET-23::GFP in cytoplasmic foci. (J–L) <i>rab-7(ok511)</i>; <i>lin-2(e1309)</i>; <i>gaIs27(let-23::GFP)</i> larva with LET-23::GFP localization similar to that in <i>rab-7(ok511)</i>; <i>gaIs27(let-23::GFP)</i> larvae. Bar, 10 µm (C).</p
    corecore