1,847,237 research outputs found

    Du lin sauvage au lin cultivé

    No full text
    National audienceLe lin actuellement cultivé correspond à l'espèce domestique (Linum usitatissimum L.) qui dérive de l'exploitation de l'ancêtre sauvage, le lin bisannuel ou lin à feuilles étroites (Linum bienne Mill.). L'adaptabilité du lin sauvage à différentes conditions environnementales permet d'expliquer sa large répartition géographique, du Caucase au Nord de l'Afrique et de la Méditerranée à l'Europe occidental

    Spatial Chow-Lin Methods for Data Completion in Econometric Flow Models

    Full text link
    Flow data across regions can be modeled by spatial econometric models, see LeSage and Pace (2009). Recently, regional studies became interested in the aggregation and disaggregation of flow models, because trade data cannot be obtained at a disaggregated level but data are published on an aggregate level. Furthermore, missing data in disaggregated flow models occur quite often since detailed measurements are often not possible at all observation points in time and space. In this paper we develop classical and Bayesian methods to complete flow data. The Chow and Lin (1971) method was developed for completing disaggregated incomplete time series data. We will extend this method in a general framework to spatially correlated flow data using the cross-sectional Chow-Lin method of Polasek et al. (2009). The missing disaggregated data can be obtained either by feasible GLS prediction or by a Bayesian (posterior) predictive density.Missing values in spatial econometrics, MCMC, non-spatial Chow-Lin (CL) and spatial Chow-Lin (SCL) methods, spatial internal flow (SIF) models, origin and destination (OD) data

    SPATIAL CHOW-LIN METHODS: BAYESIAN AND ML FORECAST COMPARISONS

    Full text link
    Completing data that are collected in disaggregated and heterogeneous spatial units is a quite frequent problem in spatial analyses of regional data. Chow and Lin (1971) (CL) were the rst to develop a uni ed framework for the three problems (interpolation, extrapolation and distribution) of predicting disaggregated times series by so-called indicator series. This paper develops a spatial CL procedure for disaggregating cross-sectional spatial data and compares the Maximum Likelihood and Bayesian spatial CL forecasts with the naive pro rata error distribution. We outline the error covariance structure in a spatial context, derive the BLUE for the ML estimator and the Bayesian estimation procedure by MCMC. Finally we apply the procedure to European regional GDP data and discuss the disaggregation assumptions. For the evaluation of the spatial Chow-Lin procedure we assume that only NUTS 1 GDP is known and predict it at NUTS 2 by using employment and spatial information available at NUTS 2. The spatial neighborhood is de ned by the inverse travel time by car in minutes. Finally, we present the forecast accuracy criteria comparing the predicted values with the actual observations.

    Singaporemma wulongensis Lin & Li 2014

    No full text
    Singaporemma wulongensis Lin & Li, 2014 Figures 6E–e, 7F Singaporemma wulongensis Lin & Li, 2014: 46, figs 7–9, 17, 20B Examined material. Holotype ♂, paratypes 8♂ and 20♀ (NHMSU), CHINA: Chongqing, Wulong, Tudi Town, Tiansheng Village, Xiaodong Cave, 29°31.853'N, 107°50.817'E, altitude 1050 m, 17 October 2010, L. Dou and Y. Lin leg. Diagnosis. Male of S. wulongensis differs from males of all other congeners with the exception of S. bifurcata by the furcate embolus (Fig. 6E–e vs. Fig. 6A–D, 6a–d, 6G–H, 6g –h); it differs from male of S. bifurcata by the narrower, longer oval bulb, the embolus with two equilong tip branches, and the embolus starts from the submesialback surface of bulb, but the embolus of S. bifurcata with asymmetric branches that origins from prolateral surface of bulb (Fig. 6E–e vs. Fig. 6F–f). Female of S. wulongensis seems also close to S. bifurcata having a similar vulval structure, but it can be distinguished by the lager “ω”-shaped inner vulval plate, and the longer, weakly sclerotized central process (Fig. 7F vs. Fig. 7D). Description. See Lin & Li, 2014: 46. Distribution. China (Chongqing) (Fig. 10).Published as part of Yan, Fanhu & Lin, Yucheng, 2018, A review of the spider genus Singaporemma (Araneae: Tetrablemmidae), with the description of a new species, pp. 329-346 in Zootaxa 4392 (2) on pages 344-345, DOI: 10.11646/zootaxa.4392.2.6, http://zenodo.org/record/119544

    Glenea changchini Lin & Lin, 2011, sp. nov.

    No full text
    Glenea changchini sp. nov. (Figs 1–8) Description (based on three males): Male: length: 21.8 –24.0 mm, humeral width: 6.2–6.7 mm. Body dark violet. Head violet-black, with two light blue pubescent stripes on occiput, which extend around superior eye lobes and antennal tubercles. Frons with inferior eye lobes surrounded with light blue pubescent stripes which cross genae and reaching clypeus; tempora covered with light blue pubescence. Antenna red brown, basal three antennomeres darker and with light blue pubescence on ventral and inner sides, others with a faint grayish pubescence. Prothorax dark violet, pronotum with three light blue pubescent stripes (one median and one on each lateral margin) and each side with a large white patch around coxa (propleura pubescent). Scutellum with white or light blue pubescence. Elytron dark violet, with 9–11 snow-white or light blue markings (named in Fig. 3); A, B at basal fourth and C at apical fourth are more stable than others in both position and shape; D and d are smaller and sometimes absent; E-e, F-f and G-g forming oblique lines and sometimes confluent; e, f and g are quite variable in shape. Ventral surface reddishviolet; with several whitish maculae: mesepisternum, mesepimeron and most of metepisternum whitish pubescent; two patches on each side of apical abdominal segments 1–4; other parts with fulvous brown pubescence. Femora reddish-brown and glossy; tibiae and tarsi reddish-brown and with hair and pubescence, especially apical part of hind tibiae and tarsi densely covered with fulvousbrown hair and pubescence. Head slightly narrower than prothorax. Eyes medially emarginate, inferior eyelobes two times as high as genae below. Antennae relative slender, longer than body (9 th antennomere reaching elytral apex); antennomere ratio: male: 25: 5: 40: 30: 30: 27: 27: 23: 23: 22: 30. Last antennomere (Fig. 4) subdivided at apical third. Prothorax densely punctured, slightly narrower from base to apex. Elytron densely and coarsely punctured, gradually narrower apically, with 2 lateral carinae, neither from base nor reaching apex; apex transversely truncated, rounded at inner angle and with a very minute and scarcely perceptible tooth at outer angle. Legs slender, middle tibiae hardly grooved, hind femur reaching fourth abdominal segment, first hind tarsal segment subequal to following two segments combined. Tarsal claws simple. Male genitalia (Figs 5–7): Tegmen length about 3.4 mm; lateral lobes stout, each about 0.7 mm long and 0.3 mm wide, with a curved ridge at base; apex with fine setae shorter than half of lateral lobes; basal piece well-developed and not bifurcated; median lobe plus median struts slightly curved (Fig. 5 b), obviously longer than tegmen (22: 17); median struts more than half of whole median lobe in length; dorsal plate shorter than ventral plate; apex of ventral plate (Fig. 6) rounded; median foramen elongated, pointed at apex (angle about 30 degree); internal sac more than twice as long as median lobe plus median struts, with four pieces of basal armature (located at middle of median struts), two bands of supporting armature (very weak), and three rods of endophallus, rods subequal, each about 3.8 mm, longer than tegmen. Tergite VIII (Figs 8 a, 8 c) much broader than long, apex truncated to slightly emarginated, with moderate long setae at sides, setae in the middle shorter and sparser. Sternite IX subequal to ringed part of tegmen in length. Female unknown. Diagnosis. Though the external appearance is similar to G. diana, G. paradiana and G. subsimilis, this species differs not only by the pubescent markings, but also in the following characters: elytral apex rounded at the inner angle (usually bidentate in Glenea), claws simeple, and basal armature located at middle of median struts (usually located out of median lobe in other Glenea spp.). Etymology. The species is named after Mr. Changchin Chen (Tianjin, China), who offered the authors lots of material, support and kind help in various ways. Remarks. The species is similar to subgenera Rubroglenea (pronotal puncturation and elytral apex different) and Macroglenea (male claw, genitalia and elytral apex different). The genus Glenea, as considered here, includes a diverse, and probably multi-generic assemblage of species. For example, some Heteroglenea species were previously placed in Glenea (Lin et. al, 2009). To clarify the subgeneric and generic relationships, a world-wide study of Glenea is required. Distribution. China: Yunnan. Material examined. Holotype (23.0 mm long), male, China, Yunnan prov., Jinping county, Ma’andi, Biaoshuiyan (22 ° 44 'N 103 ° 29 'E), alt. 1350 m, 2010. V. 13, leg. Xiaodong Yang (IZAS, IOZ (E) 1859451). Paratypes: 1 male, Yunnan prov., Jinping county, Ma’andi, Biaoshuiyan (22 ° 44 'N 103 ° 29 'E), alt. 1350 m, 2010. V. 15, leg. Wenhsin Lin (CCCC); 1 male (21.8 mm long), same data (IZAS, IOZ (E) 1859452). Correction. In the paper “Eight species of the genus Glenea Newman, 1842 from the Oriental Region, with description of three new species (Coleoptera: Cerambycidae: Lamiinae: Saperdini). Zootaxa, 2155: 1–22 ”, there is an error which needs correction. In Figures 25–26 on page 12, ‘ subrubricollis ’ in 25 L and 26 L should read ‘ nigrorubricollis ’. We thank Dr. Carolus Holzschuh (Villach, Austria) for bringing this to our attention.Published as part of Lin, Meiying & Lin, Wenhsin, 2011, Glenea changchini sp. nov. from Yunnan of China (Coleoptera: Cerambycidae: Lamiinae: Saperdini), pp. 13-17 in Zootaxa 2987 on pages 13-14, DOI: 10.5281/zenodo.20811

    A Lin-Kernighan Heuristic for Single Row Facility Layout

    Full text link
    The single row facility layout problem (SRFLP) is the problem of arranging facilities with given lengths on a line, while minimizing the weighted sum of the distances between all pairs of facilities. The problem is known to be NP-hard. In this paper, we present a neighborhood search heuristic called LK-INSERT which uses a Lin-Kernighan neighborhood structure built on insertion neighborhoods. To the best of our knowledge this is the first such heuristic for the SRFLP. Our computational experiments show that LK-INSERT is competitive and improves the best known solutions for several large sized benchmark SRFLP instances.

    Liphistius liz Lin & Li 2023, sp. nov.

    No full text
    <p>Liphistius liz Lin & Li, 2023 sp. nov.</p> <p>Materials</p> <p> <b>Type status:</b> Holotype. <b>Occurrence:</b> catalogNumber: IZCAS-Ar44748; recordedBy: Yicheng Lin; individualCount: 1; sex: male; lifeStage: adult; occurrenceID: 5BCC41FF-4DC2-53C5-836F-F9BBC80D4BDE; <b>Taxon:</b> scientificName: Liphistius liz; <b>Location:</b> country: China; stateProvince: Yunnan; county: Lianghe; locality: Jiubao Achang Township, Shizunao; verbatimElevation: 1200 m; decimalLatitude: 24.7478; decimalLongitude: 98.2106; <b>Identification:</b> identifiedBy: Yejie Lin; dateIdentified: 2023; <b>Event:</b> year: 2023; month: 5; day: 13 <b>Type status:</b> Paratype. <b>Occurrence:</b> catalogNumber: IZCAS-Ar44749; recordedBy: Yicheng Lin; individualCount: 1; sex: female; lifeStage: adult; occurrenceID: 2177DB32-CFCD-5FED-9AAF-D1629797C869; <b>Taxon:</b> scientificName: Liphistius liz; <b>Location:</b> country: China; stateProvince: Yunnan; county: Lianghe; locality: Jiubao Achang Township, Shizunao; verbatimElevation: 1200 m; decimalLatitude: 24.7478; decimalLongitude: 98.2106; <b>Identification:</b> identifiedBy: Yejie Lin; dateIdentified: 2023; <b>Event:</b> year: 2023; month: 8; day: 12 <b>Type status:</b> Paratype. <b>Occurrence:</b> catalogNumber: IZCAS-Ar44750; recordedBy: Yicheng Lin; individualCount: 1; sex: female; lifeStage: adult; occurrenceID: 4FEE7ED6-6BCF-50BB-A7A5-D3C318237341; <b>Taxon:</b> scientificName: Liphistius liz; <b>Location:</b> country: China; stateProvince: Yunnan; county: Lianghe; locality: Jiubao Achang Township, Shizunao; verbatimElevation: 1200 m; decimalLatitude: 24.7478; decimalLongitude: 98.2106; <b>Identification:</b> identifiedBy: Yejie Lin; dateIdentified: 2023; <b>Event:</b> year: 2023; month: 8; day: 12 <b>Type status:</b> Paratype. <b>Occurrence:</b> catalogNumber: IZCAS-Ar44751; recordedBy: Yicheng Lin; individualCount: 1; sex: female; lifeStage: adult; occurrenceID: 34FCBAD1-1985-59EA-8784-A3605859BC42; <b>Taxon:</b> scientificName: Liphistius liz; <b>Location:</b> country: China; stateProvince: Yunnan; county: Lianghe; locality: Jiubao Achang Township, Shizunao; verbatimElevation: 1200 m; decimalLatitude: 24.7478; decimalLongitude: 98.2106; <b>Identification:</b> identifiedBy: Yejie Lin; dateIdentified: 2023; <b>Event:</b> year: 2023; month: 8; day: 12 <b>Type status:</b> Paratype. <b>Occurrence:</b> catalogNumber: IZCAS-Ar44752; recordedBy: Yicheng Lin; individualCount: 1; sex: female; lifeStage: adult; occurrenceID: BB3338CB-0A61-516F-BEA2-1CA2A06BA8E9; <b>Taxon:</b> scientificName: Liphistius liz; <b>Location:</b> country: China; stateProvince: Yunnan; county: Lianghe; locality: Jiubao Achang Township, Shizunao; verbatimElevation: 1200 m; decimalLatitude: 24.7478; decimalLongitude: 98.2106; <b>Identification:</b> identifiedBy: Yejie Lin; dateIdentified: 2023; <b>Event:</b> year: 2023; month: 8; day: 12</p> <p>Description</p> <p>Male (holotype, Figs 2, 3 b, 4, 7 A). Total length 7.55. Carapace 4.19 long and 3.83 wide, earthy yellow in ethanol (slightly lighter than in life), margin and fovea colour darker, without obvious dark stripes between coxal elevations (Fig. 7 A). Eye sizes and interdistances: AME 0.06, ALE 0.49, PME 0.25, PLE 0.35, AME-AME 0.08, AME-ALE 0.08, PME-PME 0.04, PME-PLE 0.06, AME-PME 0.02, ALE-PLE 0.05. Chelicerae reduced, brown, with several short macrosetae. Labium 0.73 long and 0.44 wide, fused with sternum. Sternum 1.98 long and 0.75 wide, posterior tip elongated. Opisthosoma 3.54 long and 2.29 wide, with ten tergites. Leg measurements: leg I 11.86 (3.26, 3.85, 3.17, 1.58), leg II 13.46 (3.83, 4.07, 3.51, 2.05), leg III 14.88 (3.53, 4.30, 4.47, 2.58), leg IV 19.41 (4.69, 5.51, 5.91, 3.30).</p> <p>Palp (Figs 2, 3 b, 4). Tibial apophysis of palp almost as high as wide, situated near retrolateral margin of tibia, with four megaspines. Cymbium with two clavate trichobothria retrolaterally (Fig. 4 D). Paracymbium large and thick, almost as wide as cymbium, cumulus distinctly elevated with many long setae (Fig. 4). Subtegulum curved in prolaterodorsal and ventral views, without obvious apophysis. Tegulum with a well-developed and denticulate distal edge. Half of the contrategulum strongly sclerotised, with a ventral process (Figs 2, 3 b). Paraembolic plate slightly elevated. Embolus partly sclerotised, with some longitudinal ridges extending to the tip, margins of these ridges slightly dentated (Figs 2, 3 b).</p> <p>Female (paratype, Figs 1, 5, 7 B). Total length 10.32. Carapace 4.87 long, 4.16 wide, colour as in males, except shades being darker (Figs 1, 7 B). Eye sizes and interdistances: AME 0.06, ALE 0.45, PME 0.27, PLE 0.31, AME-AME 0.06, AME-ALE 0.07, PME-PME 0.04, PME-PLE 0.05, AME-PME 0.04, ALE-PLE 0.05. Chelicerae robust, reddish-brown, with a few short stripes on dorsal side and several long macrosetae on retrolateral edge of fang groove. Labium 1.03 long, 0.52 wide. Sternum 242 long, 1.23 wide. Opisthosoma 5.92 long, 4.52 wide, with ten tergites. Leg measurements: leg I 8.60 (3.04, 2.77, 1.75, 1.04), leg II 8.63 (2.68, 3.16, 1.65, 1.14), leg III 9.80 (2.98, 3.14, 2.28, 1.48), leg IV 14.34 (3.93, 4.47, 3.83, 2.11).</p> <p>Vulva (Fig. 5): Poreplate with four notobvious protuberances (two anterolateral and two posterolateral), two posterolateral protuberances not attached to ventral rim of poreplate. Central dorsal opening globular, receptacular cluster grape-shaped. Bulging margins on ventral poreplate only extending to the posterolateral corner of poreplate (Fig. 5 B) and distance between bulging margins almost as wide as poreplate. Genital atrium straight. Posterior area of posterior stalk located in the same plane of poreplate and almost as wide as poreplate (Fig. 5 A).</p> <p>Diagnosis</p> <p> Males of the new species resemble <i>Liphistius nabang</i> Yu, Zhang & Zhang, 2021 by the general shape of the embolus and tegulum with a clearly outlined distal edge (Fig. 3) and similar body colouration (Fig. 7) and the female with a similar-shaped poreplate plate. However, <i>L. liz</i> sp. nov. can be distinguished by the male with curved subtegulum (Fig. 2) [vs. subtegulum straight in <i>L. nabang</i> (see Yu et al. (2021), figs. 3A and B)] and tibial apophysis almost as high as wide (Fig. 4) [vs. wider than high in <i>L. nabang</i> (see Yu et al. (2021), figs. 3 D-F)]. Females of the new species can be distinguished from those of <i>L. nabang</i> by the straight genital atrium (Figs 5, 6) [vs. genital atrium curved in <i>L. nabang</i> (see Yu et al. (2021), fig. 4)], posterior stalk and poreplate are located in the same plane (Figs 5, 6) [vs. posterior stalk perpendicular to poreplate in <i>L. nabang</i> (see Yu et al. (2021), fig. 4)] and posterior stalk two times longer than wide [vs. posterior stalk four times longer than wide in <i>L. nabang</i> (see Yu et al. (2021), fig. 4)].</p> <p>Etymology</p> <p>The specific name refers to the short name for the Laboratory of Invertebrate Zoology (LIZ), Institute of Zoology, Chinese Academy of Sciences in Beijing; noun in apposition. LIZ was founded by Shen Jia-Rui (see Dai (1997)) in 1928, later led by Daxiang Song (see Marusik (2008)) from 1975 to 1995 and has been led by the senior author Shuqiang Li from 1995 to the present.</p> <p>Distribution</p> <p>China (Yunnan; Fig. 8).</p> <p>DNA barcode</p> <p>CTGCGATGGTTATATTCAACAAATCACAAAGATATTGGAACTATATATTTAATTTTTGGTGTATGATCTGCCATAATCGGAACTGCACTAAGATTATTAATTCGAGCAGAATTAGGTCAACCAGGAAGATTAATCGGAGACGATCAAACATATAATGTAATTGTAACAGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCTATAATAATTGGAGGTTTTGGAAATTGATTAATCCCTCTTATACTAAGAGCCCCTGATATAGCTTTTCCTCGATTAAATAATTTAAGATTTTGATTATTACCCCCCTCTATCACCCTCTTATTGATTTCATCCATAGTAGAAAGAGGCTCCGGCACAGGTTGGACTATTTATCCCCCTATTGCTAGCATAGAATTTCACCCTGGTATATCTATTGATTATACTATTTTTTCATTACACCTTGCCGGGGCCTCTTCAATCTTAGGCGCAATTAATTTTATTACCACTATTATTAACATACGACCAAGAGGTATATTAATAGAGCGAGTACCATTATTTGTTTGATCTATTCTTATTACCGCAAGCCTACTGTTACTATCTTTACCTGTATTAGCTGGTGCGATTACTATGCTATTAACAGATCGAAATTTTAACACGTCATTTTTTGATCCAGCAGGAGGTGGTGACCCTATCCTATTCCAACATTTATTTTGATTTTTTGGTCATCCAGAAGTTTACATTCTTATTATTCCAGGTTTTGGGATAATTTCACATATTGTAAGACACAACGCTGGAAAAAAAGAACCTTTTGGGTCTTTAGGCATAATTTATGCAATATCCGCTATTGGATTACTAGGGTTTGTAGTCTGAGCACACCATATATTTACAGTAGGTATAGATGTTGATACACGAGCTTATTTCACAGCAGCAACCATAATTATTGCAATCCCCACAGGAATTAAAATTTTTAGATGATTAGCTACTCTTCATGGTACTAATTTAATCATAAGTACTTCCCTAATATGGTCTATTGGATTTATCTTCCTATTCACTATTGGTGGATTAACAGGCGTAATCCTAGCTAATTCATCTATTGATATTGTTCTTCATGATACATACTATGTAGTAGCTCATTTTCATTATGTTTTATCAATAGGAGCAGTTTTTGCAATTATAGCAAGAATTATTCACTGATTCCCTTTATTTTTTGGATTTTCATTTAATCAAACTTTATTAAAAATTAACTTTTTTTCCATATTTATTGGTGTAAATATAACCTTTTTCCCACAACACTTCTTAGGATTAAATGGAATACCACGACGATATTCAGATTACCCTGATATATTTATATCATGAAATGTAATTTCATCTTTAGGAAGAATTTTATCTTTTCTAGCAGTAATTATATTTATTTTAATTGTATGAGAAAGAATTATATCGAACCGTAATATTTATATTCCTACTCAATCACCTTCTTCAGTTGAATGAACTCAAAATATTCCTCCTTCTAATCATACCTTTAATCAACTCAATATACTCATTTTCTAA (GenBank accession number OR721885).</p> <p>Compared material examined</p> <p> <i>Liphistius nabang</i>: Holotype: ♂ (MHBU-ARA-00020000), CHINA, Yunnan Province, Dehong Dai and Jingpo Autonomous Prefecture, Yingjiang County, Nabang Town, 24.7521°N, 97.563°E, 265 m elev., 2 August 2019, leg. Quanyu Ji.</p> <p>Variation</p> <p>Vulvae of two paratype females, see Fig. 6.</p>Published as part of <i>Lin, Yejie & Li, Shuqiang, 2023, A new species of Liphistius Schiodte, 1849 (Araneae, Liphistiidae) from Yunnan, China, pp. 113290 in Biodiversity Data Journal 11</i> on page 113290, DOI: 10.3897/BDJ.11.e11329

    Lysmata bahia Rhyne & Lin 2006

    No full text
    Lysmata bahia Rhyne & Lin, 2006 (Figure 7F) Material examined. Penaeid—1 OF; CL: 9.4 mm; CZUFS CRU- 00317. Stations. Penaeid—4. Distribution. Western Atlantic—Panama (Bocas Del Toro), and Brazil (Ceará, Sergipe, Bahia, Rio de Janeiro, and São Paulo) (Rhyne & Lin 2006; Baeza 2008; Barros-Alves et al. 2015; Pachelle et al. 2016). Ecological notes. Found at 5 m depth, on non-consolidated bottoms, on reefs, and inside calcareous algae (Almeida et al. 2012). Remarks. Part of a monophyletic group composed of Lysmata gacilirostris Wicksten, L. pederseni Rhyne & Lin, L. ankeri Rhyne & Lin, L. nayaritensis Wiksten, L. californica (Stimpson), and L. bahia supported by phylogenetic analysis (Baeza 2010). Previous records in Sergipe. Barros-Alves et al. (2015).Published as part of Mendonça, Luana M. C., Guimarães, Carmen R. P., Santos, Rafael C., Alves, Douglas F. R., Barros-Alves, Samara P., Silva, Sonja L. R. & Hirose, Gustavo L., 2019, Decapod crustaceans from the continental shelf of Sergipe, northeastern Brazil, pp. 301-344 in Zootaxa 4712 (3) on page 330, DOI: 10.11646/zootaxa.4712.3.1, http://zenodo.org/record/358631

    EMI-reduction design for the stabilization of LIN communication system

    No full text
    ������ ������������������ ��������������� ��������� ��������� ��������������� ������ ��������������� ��������� ������������ ������ ��������� ��������� ��������� ������ ��������� ��������� ��������� ������������ ������.��� ������������ ��������� ������ ������ ��������� ������ ������������ ��������������� LIN (Local Interconnect Network) ������ ������������ ��������� ������ ��������� ��������������� ��������� ��������� ��������� ������������ ��������� ��������������������� ������ ��������� ��������� ������������ ������������������ LIN ������ ��������������� ������������������ ��� ��������� ��������� ������������ ��������� ������������ ���������. ��������� ��������������� ������ ��������������� ������������ ��������� ������ ��������� ������ ��������� EMI (Electromagnetic Interference)��� ��������� ��������� ������������ ������. ��������������� ������ ������������ ������ EMI������. ��������������� ��������� ������������ ������ ������ EMI ��������� ������������ ������. ��������������� ������ ��������������� ������������ ������ ������ ��������� ��������� ������ ��� ��� ������. ��������� ������������ ��������� ��������� LIN ������ ������������ ��� ������������ EMI��� ������ ��� ������ ��������� ������������. EMI ��������� ��������� LIN ������ ������������ ��� ��������������� ��������� ��������� ������ ��� ������. ��� ��������������� LIN ������ ������������ ��� EMI ��������� ��������� EMC (Electromagnetic Compatibility) ������ ��������� ������������ ��������� EMI ������ ������, ��������� ��� ������ ������ ��������� ������������ PCB (Printed Circuit Board) ������, EMI ������ ������ ��� ������ ������������ ������ LIN ������ ������������ ��� ������ ��������� ��������� ������������ EMI��� ������������ ��������� ��� ������. ������ LIN ������ ��������������� EMI ��������� ������ ������ LIN ������ ��������� LIN ��������� ������ ��� ��� ������ ��������� ������(������������ 250pF ������ ������)��� ��������� EMI ������ ��������� ������������ ��������� ��� ��������������� LIN ��������� L/C (Inductor/Capacitor) ������������������ CE (Conducted Emission) ������ AM (Amplitude Modulation)������(530kHz ~ 1,600kHz)������ EMI ��������� ��� ��������� ��������� ��������� ��� ������.Maste

    Book Reviews of Lin, Y.-L.: Mesoscale Dynamics

    No full text
    Buchbesprechung Lin, Y.-L., 2007: Mesoscale Dynamic
    corecore