1,720,952 research outputs found
Vascular endothelial growth factor restores delayed tumor progression in tumors depleted of macrophages
Full text linkGenetic depletion of macrophages in Polyoma Middle T oncoprotein (PyMT)-induced mammary tumors in mice delayed the angiogenic switch and the progression to malignancy. To determine whether vascular endothelial growth factor A (VEGF-A) produced by tumor-associated macrophages regulated the onset of the angiogenic switch, a genetic approach was used to restore expression of VEGF-A into tumors at the benign stages. This stimulated formation of a high-density vessel network and in macrophage-depleted mice, was followed by accelerated tumor progression. The expression of VEGF-A led to a massive infiltration into the tumor of leukocytes that were mostly macrophages. This study suggests that macrophage-produced VEGF regulates malignant progression through stimulating tumor angiogenesis, leukocytic infiltration and tumor cell invasion
Sen lin lun li he duo jia zhi sen lin guan li
No full textText in Chinese.James Coufal, co-author, is in the College of Environmental Science and Forestry, State University of New York, Syracuse, and is former president of SAF.The Society of American Foresters (SAF) has long had an ethic of using forests to benefit society. Now many foresters, prompted by Aldo Leopold and his land ethic, are wondering if SAF does not need a forest ethic, respecting the integrity of natural systems, to complement its ethic for society. Forests are communities as well as commodities. Forest management ought to expand from an ethical of multiple use to one of protecting multiple values found in forests
Liphistius liz Lin & Li 2023, sp. nov.
No full text<p>Liphistius liz Lin & Li, 2023 sp. nov.</p> <p>Materials</p> <p> <b>Type status:</b> Holotype. <b>Occurrence:</b> catalogNumber: IZCAS-Ar44748; recordedBy: Yicheng Lin; individualCount: 1; sex: male; lifeStage: adult; occurrenceID: 5BCC41FF-4DC2-53C5-836F-F9BBC80D4BDE; <b>Taxon:</b> scientificName: Liphistius liz; <b>Location:</b> country: China; stateProvince: Yunnan; county: Lianghe; locality: Jiubao Achang Township, Shizunao; verbatimElevation: 1200 m; decimalLatitude: 24.7478; decimalLongitude: 98.2106; <b>Identification:</b> identifiedBy: Yejie Lin; dateIdentified: 2023; <b>Event:</b> year: 2023; month: 5; day: 13 <b>Type status:</b> Paratype. <b>Occurrence:</b> catalogNumber: IZCAS-Ar44749; recordedBy: Yicheng Lin; individualCount: 1; sex: female; lifeStage: adult; occurrenceID: 2177DB32-CFCD-5FED-9AAF-D1629797C869; <b>Taxon:</b> scientificName: Liphistius liz; <b>Location:</b> country: China; stateProvince: Yunnan; county: Lianghe; locality: Jiubao Achang Township, Shizunao; verbatimElevation: 1200 m; decimalLatitude: 24.7478; decimalLongitude: 98.2106; <b>Identification:</b> identifiedBy: Yejie Lin; dateIdentified: 2023; <b>Event:</b> year: 2023; month: 8; day: 12 <b>Type status:</b> Paratype. <b>Occurrence:</b> catalogNumber: IZCAS-Ar44750; recordedBy: Yicheng Lin; individualCount: 1; sex: female; lifeStage: adult; occurrenceID: 4FEE7ED6-6BCF-50BB-A7A5-D3C318237341; <b>Taxon:</b> scientificName: Liphistius liz; <b>Location:</b> country: China; stateProvince: Yunnan; county: Lianghe; locality: Jiubao Achang Township, Shizunao; verbatimElevation: 1200 m; decimalLatitude: 24.7478; decimalLongitude: 98.2106; <b>Identification:</b> identifiedBy: Yejie Lin; dateIdentified: 2023; <b>Event:</b> year: 2023; month: 8; day: 12 <b>Type status:</b> Paratype. <b>Occurrence:</b> catalogNumber: IZCAS-Ar44751; recordedBy: Yicheng Lin; individualCount: 1; sex: female; lifeStage: adult; occurrenceID: 34FCBAD1-1985-59EA-8784-A3605859BC42; <b>Taxon:</b> scientificName: Liphistius liz; <b>Location:</b> country: China; stateProvince: Yunnan; county: Lianghe; locality: Jiubao Achang Township, Shizunao; verbatimElevation: 1200 m; decimalLatitude: 24.7478; decimalLongitude: 98.2106; <b>Identification:</b> identifiedBy: Yejie Lin; dateIdentified: 2023; <b>Event:</b> year: 2023; month: 8; day: 12 <b>Type status:</b> Paratype. <b>Occurrence:</b> catalogNumber: IZCAS-Ar44752; recordedBy: Yicheng Lin; individualCount: 1; sex: female; lifeStage: adult; occurrenceID: BB3338CB-0A61-516F-BEA2-1CA2A06BA8E9; <b>Taxon:</b> scientificName: Liphistius liz; <b>Location:</b> country: China; stateProvince: Yunnan; county: Lianghe; locality: Jiubao Achang Township, Shizunao; verbatimElevation: 1200 m; decimalLatitude: 24.7478; decimalLongitude: 98.2106; <b>Identification:</b> identifiedBy: Yejie Lin; dateIdentified: 2023; <b>Event:</b> year: 2023; month: 8; day: 12</p> <p>Description</p> <p>Male (holotype, Figs 2, 3 b, 4, 7 A). Total length 7.55. Carapace 4.19 long and 3.83 wide, earthy yellow in ethanol (slightly lighter than in life), margin and fovea colour darker, without obvious dark stripes between coxal elevations (Fig. 7 A). Eye sizes and interdistances: AME 0.06, ALE 0.49, PME 0.25, PLE 0.35, AME-AME 0.08, AME-ALE 0.08, PME-PME 0.04, PME-PLE 0.06, AME-PME 0.02, ALE-PLE 0.05. Chelicerae reduced, brown, with several short macrosetae. Labium 0.73 long and 0.44 wide, fused with sternum. Sternum 1.98 long and 0.75 wide, posterior tip elongated. Opisthosoma 3.54 long and 2.29 wide, with ten tergites. Leg measurements: leg I 11.86 (3.26, 3.85, 3.17, 1.58), leg II 13.46 (3.83, 4.07, 3.51, 2.05), leg III 14.88 (3.53, 4.30, 4.47, 2.58), leg IV 19.41 (4.69, 5.51, 5.91, 3.30).</p> <p>Palp (Figs 2, 3 b, 4). Tibial apophysis of palp almost as high as wide, situated near retrolateral margin of tibia, with four megaspines. Cymbium with two clavate trichobothria retrolaterally (Fig. 4 D). Paracymbium large and thick, almost as wide as cymbium, cumulus distinctly elevated with many long setae (Fig. 4). Subtegulum curved in prolaterodorsal and ventral views, without obvious apophysis. Tegulum with a well-developed and denticulate distal edge. Half of the contrategulum strongly sclerotised, with a ventral process (Figs 2, 3 b). Paraembolic plate slightly elevated. Embolus partly sclerotised, with some longitudinal ridges extending to the tip, margins of these ridges slightly dentated (Figs 2, 3 b).</p> <p>Female (paratype, Figs 1, 5, 7 B). Total length 10.32. Carapace 4.87 long, 4.16 wide, colour as in males, except shades being darker (Figs 1, 7 B). Eye sizes and interdistances: AME 0.06, ALE 0.45, PME 0.27, PLE 0.31, AME-AME 0.06, AME-ALE 0.07, PME-PME 0.04, PME-PLE 0.05, AME-PME 0.04, ALE-PLE 0.05. Chelicerae robust, reddish-brown, with a few short stripes on dorsal side and several long macrosetae on retrolateral edge of fang groove. Labium 1.03 long, 0.52 wide. Sternum 242 long, 1.23 wide. Opisthosoma 5.92 long, 4.52 wide, with ten tergites. Leg measurements: leg I 8.60 (3.04, 2.77, 1.75, 1.04), leg II 8.63 (2.68, 3.16, 1.65, 1.14), leg III 9.80 (2.98, 3.14, 2.28, 1.48), leg IV 14.34 (3.93, 4.47, 3.83, 2.11).</p> <p>Vulva (Fig. 5): Poreplate with four notobvious protuberances (two anterolateral and two posterolateral), two posterolateral protuberances not attached to ventral rim of poreplate. Central dorsal opening globular, receptacular cluster grape-shaped. Bulging margins on ventral poreplate only extending to the posterolateral corner of poreplate (Fig. 5 B) and distance between bulging margins almost as wide as poreplate. Genital atrium straight. Posterior area of posterior stalk located in the same plane of poreplate and almost as wide as poreplate (Fig. 5 A).</p> <p>Diagnosis</p> <p> Males of the new species resemble <i>Liphistius nabang</i> Yu, Zhang & Zhang, 2021 by the general shape of the embolus and tegulum with a clearly outlined distal edge (Fig. 3) and similar body colouration (Fig. 7) and the female with a similar-shaped poreplate plate. However, <i>L. liz</i> sp. nov. can be distinguished by the male with curved subtegulum (Fig. 2) [vs. subtegulum straight in <i>L. nabang</i> (see Yu et al. (2021), figs. 3A and B)] and tibial apophysis almost as high as wide (Fig. 4) [vs. wider than high in <i>L. nabang</i> (see Yu et al. (2021), figs. 3 D-F)]. Females of the new species can be distinguished from those of <i>L. nabang</i> by the straight genital atrium (Figs 5, 6) [vs. genital atrium curved in <i>L. nabang</i> (see Yu et al. (2021), fig. 4)], posterior stalk and poreplate are located in the same plane (Figs 5, 6) [vs. posterior stalk perpendicular to poreplate in <i>L. nabang</i> (see Yu et al. (2021), fig. 4)] and posterior stalk two times longer than wide [vs. posterior stalk four times longer than wide in <i>L. nabang</i> (see Yu et al. (2021), fig. 4)].</p> <p>Etymology</p> <p>The specific name refers to the short name for the Laboratory of Invertebrate Zoology (LIZ), Institute of Zoology, Chinese Academy of Sciences in Beijing; noun in apposition. LIZ was founded by Shen Jia-Rui (see Dai (1997)) in 1928, later led by Daxiang Song (see Marusik (2008)) from 1975 to 1995 and has been led by the senior author Shuqiang Li from 1995 to the present.</p> <p>Distribution</p> <p>China (Yunnan; Fig. 8).</p> <p>DNA barcode</p> <p>CTGCGATGGTTATATTCAACAAATCACAAAGATATTGGAACTATATATTTAATTTTTGGTGTATGATCTGCCATAATCGGAACTGCACTAAGATTATTAATTCGAGCAGAATTAGGTCAACCAGGAAGATTAATCGGAGACGATCAAACATATAATGTAATTGTAACAGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCTATAATAATTGGAGGTTTTGGAAATTGATTAATCCCTCTTATACTAAGAGCCCCTGATATAGCTTTTCCTCGATTAAATAATTTAAGATTTTGATTATTACCCCCCTCTATCACCCTCTTATTGATTTCATCCATAGTAGAAAGAGGCTCCGGCACAGGTTGGACTATTTATCCCCCTATTGCTAGCATAGAATTTCACCCTGGTATATCTATTGATTATACTATTTTTTCATTACACCTTGCCGGGGCCTCTTCAATCTTAGGCGCAATTAATTTTATTACCACTATTATTAACATACGACCAAGAGGTATATTAATAGAGCGAGTACCATTATTTGTTTGATCTATTCTTATTACCGCAAGCCTACTGTTACTATCTTTACCTGTATTAGCTGGTGCGATTACTATGCTATTAACAGATCGAAATTTTAACACGTCATTTTTTGATCCAGCAGGAGGTGGTGACCCTATCCTATTCCAACATTTATTTTGATTTTTTGGTCATCCAGAAGTTTACATTCTTATTATTCCAGGTTTTGGGATAATTTCACATATTGTAAGACACAACGCTGGAAAAAAAGAACCTTTTGGGTCTTTAGGCATAATTTATGCAATATCCGCTATTGGATTACTAGGGTTTGTAGTCTGAGCACACCATATATTTACAGTAGGTATAGATGTTGATACACGAGCTTATTTCACAGCAGCAACCATAATTATTGCAATCCCCACAGGAATTAAAATTTTTAGATGATTAGCTACTCTTCATGGTACTAATTTAATCATAAGTACTTCCCTAATATGGTCTATTGGATTTATCTTCCTATTCACTATTGGTGGATTAACAGGCGTAATCCTAGCTAATTCATCTATTGATATTGTTCTTCATGATACATACTATGTAGTAGCTCATTTTCATTATGTTTTATCAATAGGAGCAGTTTTTGCAATTATAGCAAGAATTATTCACTGATTCCCTTTATTTTTTGGATTTTCATTTAATCAAACTTTATTAAAAATTAACTTTTTTTCCATATTTATTGGTGTAAATATAACCTTTTTCCCACAACACTTCTTAGGATTAAATGGAATACCACGACGATATTCAGATTACCCTGATATATTTATATCATGAAATGTAATTTCATCTTTAGGAAGAATTTTATCTTTTCTAGCAGTAATTATATTTATTTTAATTGTATGAGAAAGAATTATATCGAACCGTAATATTTATATTCCTACTCAATCACCTTCTTCAGTTGAATGAACTCAAAATATTCCTCCTTCTAATCATACCTTTAATCAACTCAATATACTCATTTTCTAA (GenBank accession number OR721885).</p> <p>Compared material examined</p> <p> <i>Liphistius nabang</i>: Holotype: ♂ (MHBU-ARA-00020000), CHINA, Yunnan Province, Dehong Dai and Jingpo Autonomous Prefecture, Yingjiang County, Nabang Town, 24.7521°N, 97.563°E, 265 m elev., 2 August 2019, leg. Quanyu Ji.</p> <p>Variation</p> <p>Vulvae of two paratype females, see Fig. 6.</p>Published as part of <i>Lin, Yejie & Li, Shuqiang, 2023, A new species of Liphistius Schiodte, 1849 (Araneae, Liphistiidae) from Yunnan, China, pp. 113290 in Biodiversity Data Journal 11</i> on page 113290, DOI: 10.3897/BDJ.11.e11329
Meotipa luoqiae Lin & Li 2021, sp. nov.
No full textMeotipa luoqiae Lin & Li, sp. nov. (Figs 47A–C, 48A–B, 53G–H) Diagnosis. The new species is similar to M. spiniventris (O. Pickard-Cambridge, 1869) but can be distinguished by the presence of 2 distal spines on the opisthosoma (vs. 4 distal spines in M. spiniventris), 2 conductor apophysis, and the straight Sp in ventral view (vs. curved in M. spiniventris). Description. Male (holotype, IZCAS-Ar42467, Figs 47A–C, 48A–B, 53G–H). Total length 2.65. Prosoma 0.93 long, 0.83 wide, pale yellow, flat. Sternum 0.50 long, 0.50 wide, pale yellow. Opisthosoma 0.93 long, 0.83 wide, pale yellow, with large white and tiny dark spots; with 2 strong spines on distal part. Eyes developed: AME 0.09, ALE 0.08, PME 0.09, PLE 0.08, AME–AME 0.09, AME–ALE 0.06, PME–PME 0.09, PME–PLE 0.06. Clypeus height about 3.33 times AME diameter. Chelicerae with 1 promarginal tooth, retromarginal tooth absent. Leg I femur 2.65, patella 0.45, tibia 2.15, metatarsus 2.75, tarsus 0.85. Patella and tibia II–IV: 1.60, 0.85, 1.75. Leg I pale yellow, femur with a disto-ventral spine; patella with a distodorsal spine; tibia with 2 dorsal spines. Legs II–IV same as leg I in spination. Palp (Figs 47A–C, 48A–B) patella with a strong spine; tibia with a strong retrolateral spine; Sp linear in ventral view; C coiled at end, with 3 small outgrowths; E with 2 apophyses at middle. Female. Unknown. Material examined. Holotype ♂, China: Yunnan, Menglun Nature Reserve (21.9589°N, 101.2050°E; elev. ca. 816 m), 4 August 2007, leg. Guo Zheng (IZCAS-Ar42467). Paratype. 1♂ (IZCAS-Ar42468), same data as holotype. Distribution. Only known from type locality. Etymology. The species name is honoring the Chinese rock singer Mrs. Qi Luo, which encouraged the author by her courage, freedom and spirit of exploration; noun (name) in apposition. Variation. Male (paratype). Total length 2.05–2.65; prosoma 0.88–0.93 long, 0.73–0.83 wide; sternum 0.50–0.55 long, 0.44–0.50 wide; opisthosoma 0.93–1.13 long, 0.63–0.83 wide.Published as part of Lin, Yejie, Marusik, Yuri M., Gao, Caixia, Xu, Hao, Zhang, Xiaoqing, Wang, Ziyi, Zhu, Wenhui & Li, Shuqiang, 2021, Twenty-three new spider species (Arachnida: Araneae) from Asia, pp. 91-152 in Zoological Systematics 46 (2) on page 146, DOI: 10.11865/zs.2021201, http://zenodo.org/record/536706
Investigating future precipitation changes over China through a high-resolution regional climate model ensemble
Full text linkDue to climate change, rising temperature around the world will have a great potential to influence the global hydrologic cycle, thus leading to substantial changes in the spatial and temporal patterns of precipitation. In this study, the effects of global warming on the regional hydrologic cycle, particularly on the spatiotemporal patterns of precipitation, over China are investigated through a high-resolution regional climate ensemble. In detail, the PRECIS regional climate modeling system is employed to simulate the regional climate over China from 1950 to 2099 with a fine resolution of 25 km, driven by the boundary conditions from a four-member HadCM3-based perturbed-physics ensemble (i.e., HadCM3Q0, Q1, Q7, and Q13) and the ECHAM5 model. Historical simulations of the PRECIS ensemble are first compared to the observations to validate its performance in capturing both the spatial and temporal patterns of precipitation. The comparisons show that the PRECIS ensemble is likely to overestimate precipitation in the south and exhibits slight dry biases in the northwest and southeast coasts of China. The projections from the PRECIS ensemble for future periods (i.e., 2020s, 2050s, and 2080s) are then analyzed to help understand how the regional characteristics of precipitation will be affected in the context of global warming. It is shown that the annual mean precipitation over China is likely to increase throughout the 21st century (i.e., by 0.078 mm/d in 2020s, 0.218 mm/d in 2050s, and 0.360 mm/d in 2080s). This may suggest that the rising temperature due to climate change will intensify the regional hydrologic cycles in China. However, apparent spatial and temporal variations are also reported in the projected precipitations from the PRECIS ensemble. For example, bigger changes in precipitation are usually observed in summer; projected precipitation changes in the southeast are apparently higher than other regions. In addition, the results show that the fluctuation range of the ensemble simulations will increase with time periods from 2020s to 2080s, indicating that the longer the projecting periods, the more uncertain the projections will be
[[alternative]]The Representation of Style:On Lin Yutang’s Translation of Six Chapters of the Floating Life
No full text[[abstract]]This thesis aims at exploring how the style of Six Chapters of the Floating Life is represented in Lin Yutang’s translation. Style means distinctive characteristics of one’s writing, such as one’s choice of diction, sentence structures, images, etc. Parallel structures and vivid images give Six Chapters of the Floating Life an elegant style. This thesis is divided into four chapters. Chapter One “Lin Yutang and Six Chapters of the Floating Life” includes the introduction to Six Chapters of the Floating Life, that to Lin Yutang’s translation of the book, and the summary of some scholars’ evaluation of Lin’s translation. Chapter Two “The Evaluation of the Translation of Sentence Structures in Lin’s Version” explores Lin’s translation of parallel structures and compound sentences. Chapter Three “The Evaluation of the Translation of Figures of Speech in Lin’s Version” discusses Lin’s translation of metaphors, of antitheses and of images. Chapter Four “The Comparison of Lin’s Translation and Another Two Translations of Six Chapters of the Floating Life” analyzes the similarities and differences of these three translations in order to have a better understanding of Lin’s translation strategies.
Author Correction: Recurrent acquisition of cytosine methyltransferases into eukaryotic retrotransposons
No full textThe original version of this Article contained an error in the spelling of the author Hongfei Li, which was incorrectly given as Fei Hong. This has now been corrected in both the PDF and HTML versions of the Article.</jats:p
Episinus bonjovi Lin & Li 2021, sp. nov.
No full textEpisinus bonjovi Lin & Li, sp. nov. (Figs 38A–C, 39A–B, 40A–D, 53A–B) Diagnosis. The new species is similar to E. unitus Levi, 1964, but it can be distinguished by the larger atrium, the nephroid S, the conspicuous CD, and the medially curved FDs. Description. Male (holotype, IZCAS-Ar42451, Figs 38A–C, 40C–D, 53A). Total length 2.10. Prosoma 0.88 long, 0.68 wide, flat, pale yellow, with a broad reddish brown stripe at middle, anterior part of ocular area with two distinct processes. Sternum 0.41 long, 0.38 wide, pale yellow. Opisthosoma 1.13 long, 1.13 wide, pale yellow, with 3 protuberances and white spots. Eyes developed: AME 0.09, ALE 0.05, PME 0.06, PLE 0.06, AME–AME 0.06, AME–ALE 0.02, PME–PME 0.06, PME–PLE 0.03. Clypeus height about 1.64 times AME diameter. Leg I femur 1.55, patella 0.30, tibia 1.33, metatarsus 1.30, tarsus 0.63. Patella and tibia II–IV: 0.88, 0.63, 0.88. Legs pale yellow, tip of femur IV and base of patella reddish brown. Palp (Figs 38A–C, 40C–D). ST confined; Sp distinct in ventral view; E long and slender; TTA with tiny tubes and 2 acute protuberances; C huge. Female (paratypes, IZCAS-Ar42455, Figs 39A–B, 40A–B, 53B). Total length 3.63. Prosoma 1.03 long, 0.94 wide, flat, pale yellow, with a broad reddish brown stripe at middle, anterior part of ocular area with 2 distinct processes. Sternum 0.61 long, 0.46 wide, pale yellow. Opisthosoma 2.42 long, 3.12 wide, brown or pale, with tiny white spots and 3 protuberances. Eyes developed. Epigynum (Figs 39A–B, 40A–B). Atrium large; S nephroid; CD strong sclerotized; FDs bent at middle. Material examined. Holotype ♂, China: Yunnan, Menglun Nature Reserve (21.9588°N, 101.2064°E; elev. ca. 899 m), 6 August 2007, leg. Guo Zheng (IZCAS-Ar42451). Paratypes. 3♂ (IZCAS-Ar42452–Ar42454), 3♀ (IZCAS-Ar42455– Ar42457), same data as holotype. Distribution. Known only from the type locality. Etymology. The species name is honoring the American rock band Bon Jovi, composer of the music album "Have a Nice Day" and the singles "Because We Can" and "Living On A Prayer", which encouraged the author by their songs full of romance and freedom; noun (name) in apposition. Variation. Male (paratypes; n = 3). Total length 1.88–1.93; prosoma 0.68–0.72 long, 0.63–0.65 wide; sternum 0.35–0.38 long, 0.30–0.38 wide; opisthosoma 1.13–1.18 long, 1.13–1.18 wide. Female (paratypes; n = 3). Total length 3.25–3.75. Prosoma 1.00–1.10 long, 0.90–1.00 wide, Sternum 0.60–0.65 long, 0.48–0.50 wide, pale yellow. Opisthosoma 2.25–2.65 long, 3.00–3.25 wide.Published as part of Lin, Yejie, Marusik, Yuri M., Gao, Caixia, Xu, Hao, Zhang, Xiaoqing, Wang, Ziyi, Zhu, Wenhui & Li, Shuqiang, 2021, Twenty-three new spider species (Arachnida: Araneae) from Asia, pp. 91-152 in Zoological Systematics 46 (2) on pages 135-138, DOI: 10.11865/zs.2021201, http://zenodo.org/record/536706
Generalized Abstracted Mean Values
No full textIn this article, the author introduces the generalized abstracted mean values which extend the concepts of most means with two variables, and researches their basic properties and monotonicities
Psychometric Evaluation of the Chinese Version of the Theory of Mind Inventory for Children With Autism Spectrum Disorder
No full textAbstract
Date Presented 4/1/2017
This study developed a Chinese version of the Theory of Mind Inventory (ToMI–C) for assessing theory of mind (ToM) performance in children with autism spectrum disorder (ASD) in actual social contexts. The ToMI–C will facilitate the evaluation of the ToM of Taiwanese children with ASD accurately.
Primary Author and Speaker: Dai-Rong Jiang
Additional Authors and Speakers: Kuan-Lin Chen
Contributing Authors: Chien-Ho Lin, Li-Chen Tung, Ya-Chen Lee</jats:p
- …
