3,391 research outputs found
Differential roles of the microRNA let-7 in C. elegans tissue development
No full textThe organs and tissues of the human body comprise of an astonishing variety of cells as different in morphology and function as muscle cells and neurons. Amazingly, despite their different protein contents, they largely contain the identical genomic information. In order to understand the processes that enable this differentiation, we need to determine the underlying regulatory mechanisms. A very recent discovery in this context was the posttranscriptional regulation of gene expression by microRNAs (miRNAs). miRNAs are small RNA molecules that mediate translational repression and degradation of mRNA transcripts through partial complementarity to their 3’ untranslated region (UTR) . Among the first miRNAs to be identified, let-7 stands out for its high conservation in sequence and developmental functions in development throughout the animal kingdom. During my PhD, I studied the role of let-7 in Caenorhabditis elegans in the context of two distinct processes of tissue development, namely differentiation of the epidermis (called hypodermis), and morphogenesis of the vulva. The functions of the let-7 miRNA in formation of the adult cuticle have been extensively studied and are well understood. let-7 controls differentiation of specific, mitotically active epidermal cells by inducing cell cycle exit, fusion, and switch to an adult specific transcriptional program upon repression of targets such as lin-41, daf-12, hbl-1 and let-60/ras. I set out to identify novel interactors of let-7 in a genome-wide RNAi screen for suppression of the lethal let-7 bursting phenotype. Candidates were then verified using fluorescence-based reporter systems for onset of hypodermis differentiation and intensity of repression of a known target. Thereby, I was able to validate a whole set of novel members of the let-7 network, comprising genes downstream in the pathway as well as potential regulators of let-7 activity. Notably, both groups of repressors contain factors required for cell cycle progression and mitosis, which indicates an active crosstalk between let-7 and the cell-cycle machinery. In a second project, I explored the molecular basis for the prominent let-7 vulval bursting phenotype. Despite the absence of overproliferation or any other obvious phenotype in vulval morphogenesis, I was able to show that let-7 activity is required in the vulva, and that its major function in this context is repression of a single target, namely lin-41. Disruption of let-7 binding to lin-41 through modification of the let-7 complementary sites by CRISPR/Cas9 mediated genome editing suffices to trigger the bursting phenotype, proving that repression of a single target is the key function of the miRNA in this context. In summary, my work shows that while both differentiation of hypodermis as well as vulval integrity are mediated through repression of lin-41, the downstream effect of this regulation seem to differ, suggesting that let-7 can be wired to control distinct processes depending on the cellular context. With respect to the latest findings both in C. elegans as well as in mammals, it will be interesting to determine if this depends on differential molecular functions of LIN-41 in the two tissues
Enhancing the photoluminescence quantum yields of blue-emitting cationic iridium(III) complexes bearing bisphosphine ligands
No full textEZ-C acknowledges the University of St Andrews for financial support. We thank Johnson Matthey and Umicore AG for the gift of materials and Cihang Yu for the preparation of isopropxantphos. We thank Dr. Nail Shaveleev for the synthesis of NMS25. IDWS and AKB acknowledge support from EPSRC (EP/J01771X). This work has been supported by the Spanish Ministry of Economy and Competitiveness (MINECO) MAT2014-55200.Herein we present a structure-property relationship study of thirteen cationic iridium (III) complexes of the form of [Ir(C^N)2(P^P)]PF6 in both solution and the solid state through systematic evaluation of six bisphosphine (P^P) ligands (xantphos, dpephos, dppe, Dppe, nixantphos and isopropxantphos). All of the complexes are sky-blue emissive, but their photoluminescence quantum yield (ΦPL) are generally low. However, strong and long-lived blue luminescence (λem: 471 nm; ΦPL = 52%; τe, of 13.5 μs) can be obtained by combining the reduced bite angle of the 1,2-bis-diphenylphosphinoethene (dppe) chelate with the bulky 2-(4,6-difluorophenyl)-4-mesitylpyridinato (dFmesppy) cyclometalating ligand. To the best of our knowledge this is the highest ΦPL and the longest τe reported for cyclometalated iridium(III) complexes bearing bisphosphine ligands. Light-emitting electrochemical cells (LEECs) were fabricated using lead complexes from this study, however due in part to the irreversible electrochemistry, no functional LEEC was achieved. Organic light-emitting diodes were successfully fabricated but only attained maximum external quantum efficiencies of 0.25%.Peer reviewe
Vascular endothelial growth factor restores delayed tumor progression in tumors depleted of macrophages
No full textGenetic depletion of macrophages in Polyoma Middle T oncoprotein (PyMT)-induced mammary tumors in mice delayed the angiogenic switch and the progression to malignancy. To determine whether vascular endothelial growth factor A (VEGF-A) produced by tumor-associated macrophages regulated the onset of the angiogenic switch, a genetic approach was used to restore expression of VEGF-A into tumors at the benign stages. This stimulated formation of a high-density vessel network and in macrophage-depleted mice, was followed by accelerated tumor progression. The expression of VEGF-A led to a massive infiltration into the tumor of leukocytes that were mostly macrophages. This study suggests that macrophage-produced VEGF regulates malignant progression through stimulating tumor angiogenesis, leukocytic infiltration and tumor cell invasion
Liphistius liz Lin & Li 2023, sp. nov.
No full text<p>Liphistius liz Lin & Li, 2023 sp. nov.</p> <p>Materials</p> <p> <b>Type status:</b> Holotype. <b>Occurrence:</b> catalogNumber: IZCAS-Ar44748; recordedBy: Yicheng Lin; individualCount: 1; sex: male; lifeStage: adult; occurrenceID: 5BCC41FF-4DC2-53C5-836F-F9BBC80D4BDE; <b>Taxon:</b> scientificName: Liphistius liz; <b>Location:</b> country: China; stateProvince: Yunnan; county: Lianghe; locality: Jiubao Achang Township, Shizunao; verbatimElevation: 1200 m; decimalLatitude: 24.7478; decimalLongitude: 98.2106; <b>Identification:</b> identifiedBy: Yejie Lin; dateIdentified: 2023; <b>Event:</b> year: 2023; month: 5; day: 13 <b>Type status:</b> Paratype. <b>Occurrence:</b> catalogNumber: IZCAS-Ar44749; recordedBy: Yicheng Lin; individualCount: 1; sex: female; lifeStage: adult; occurrenceID: 2177DB32-CFCD-5FED-9AAF-D1629797C869; <b>Taxon:</b> scientificName: Liphistius liz; <b>Location:</b> country: China; stateProvince: Yunnan; county: Lianghe; locality: Jiubao Achang Township, Shizunao; verbatimElevation: 1200 m; decimalLatitude: 24.7478; decimalLongitude: 98.2106; <b>Identification:</b> identifiedBy: Yejie Lin; dateIdentified: 2023; <b>Event:</b> year: 2023; month: 8; day: 12 <b>Type status:</b> Paratype. <b>Occurrence:</b> catalogNumber: IZCAS-Ar44750; recordedBy: Yicheng Lin; individualCount: 1; sex: female; lifeStage: adult; occurrenceID: 4FEE7ED6-6BCF-50BB-A7A5-D3C318237341; <b>Taxon:</b> scientificName: Liphistius liz; <b>Location:</b> country: China; stateProvince: Yunnan; county: Lianghe; locality: Jiubao Achang Township, Shizunao; verbatimElevation: 1200 m; decimalLatitude: 24.7478; decimalLongitude: 98.2106; <b>Identification:</b> identifiedBy: Yejie Lin; dateIdentified: 2023; <b>Event:</b> year: 2023; month: 8; day: 12 <b>Type status:</b> Paratype. <b>Occurrence:</b> catalogNumber: IZCAS-Ar44751; recordedBy: Yicheng Lin; individualCount: 1; sex: female; lifeStage: adult; occurrenceID: 34FCBAD1-1985-59EA-8784-A3605859BC42; <b>Taxon:</b> scientificName: Liphistius liz; <b>Location:</b> country: China; stateProvince: Yunnan; county: Lianghe; locality: Jiubao Achang Township, Shizunao; verbatimElevation: 1200 m; decimalLatitude: 24.7478; decimalLongitude: 98.2106; <b>Identification:</b> identifiedBy: Yejie Lin; dateIdentified: 2023; <b>Event:</b> year: 2023; month: 8; day: 12 <b>Type status:</b> Paratype. <b>Occurrence:</b> catalogNumber: IZCAS-Ar44752; recordedBy: Yicheng Lin; individualCount: 1; sex: female; lifeStage: adult; occurrenceID: BB3338CB-0A61-516F-BEA2-1CA2A06BA8E9; <b>Taxon:</b> scientificName: Liphistius liz; <b>Location:</b> country: China; stateProvince: Yunnan; county: Lianghe; locality: Jiubao Achang Township, Shizunao; verbatimElevation: 1200 m; decimalLatitude: 24.7478; decimalLongitude: 98.2106; <b>Identification:</b> identifiedBy: Yejie Lin; dateIdentified: 2023; <b>Event:</b> year: 2023; month: 8; day: 12</p> <p>Description</p> <p>Male (holotype, Figs 2, 3 b, 4, 7 A). Total length 7.55. Carapace 4.19 long and 3.83 wide, earthy yellow in ethanol (slightly lighter than in life), margin and fovea colour darker, without obvious dark stripes between coxal elevations (Fig. 7 A). Eye sizes and interdistances: AME 0.06, ALE 0.49, PME 0.25, PLE 0.35, AME-AME 0.08, AME-ALE 0.08, PME-PME 0.04, PME-PLE 0.06, AME-PME 0.02, ALE-PLE 0.05. Chelicerae reduced, brown, with several short macrosetae. Labium 0.73 long and 0.44 wide, fused with sternum. Sternum 1.98 long and 0.75 wide, posterior tip elongated. Opisthosoma 3.54 long and 2.29 wide, with ten tergites. Leg measurements: leg I 11.86 (3.26, 3.85, 3.17, 1.58), leg II 13.46 (3.83, 4.07, 3.51, 2.05), leg III 14.88 (3.53, 4.30, 4.47, 2.58), leg IV 19.41 (4.69, 5.51, 5.91, 3.30).</p> <p>Palp (Figs 2, 3 b, 4). Tibial apophysis of palp almost as high as wide, situated near retrolateral margin of tibia, with four megaspines. Cymbium with two clavate trichobothria retrolaterally (Fig. 4 D). Paracymbium large and thick, almost as wide as cymbium, cumulus distinctly elevated with many long setae (Fig. 4). Subtegulum curved in prolaterodorsal and ventral views, without obvious apophysis. Tegulum with a well-developed and denticulate distal edge. Half of the contrategulum strongly sclerotised, with a ventral process (Figs 2, 3 b). Paraembolic plate slightly elevated. Embolus partly sclerotised, with some longitudinal ridges extending to the tip, margins of these ridges slightly dentated (Figs 2, 3 b).</p> <p>Female (paratype, Figs 1, 5, 7 B). Total length 10.32. Carapace 4.87 long, 4.16 wide, colour as in males, except shades being darker (Figs 1, 7 B). Eye sizes and interdistances: AME 0.06, ALE 0.45, PME 0.27, PLE 0.31, AME-AME 0.06, AME-ALE 0.07, PME-PME 0.04, PME-PLE 0.05, AME-PME 0.04, ALE-PLE 0.05. Chelicerae robust, reddish-brown, with a few short stripes on dorsal side and several long macrosetae on retrolateral edge of fang groove. Labium 1.03 long, 0.52 wide. Sternum 242 long, 1.23 wide. Opisthosoma 5.92 long, 4.52 wide, with ten tergites. Leg measurements: leg I 8.60 (3.04, 2.77, 1.75, 1.04), leg II 8.63 (2.68, 3.16, 1.65, 1.14), leg III 9.80 (2.98, 3.14, 2.28, 1.48), leg IV 14.34 (3.93, 4.47, 3.83, 2.11).</p> <p>Vulva (Fig. 5): Poreplate with four notobvious protuberances (two anterolateral and two posterolateral), two posterolateral protuberances not attached to ventral rim of poreplate. Central dorsal opening globular, receptacular cluster grape-shaped. Bulging margins on ventral poreplate only extending to the posterolateral corner of poreplate (Fig. 5 B) and distance between bulging margins almost as wide as poreplate. Genital atrium straight. Posterior area of posterior stalk located in the same plane of poreplate and almost as wide as poreplate (Fig. 5 A).</p> <p>Diagnosis</p> <p> Males of the new species resemble <i>Liphistius nabang</i> Yu, Zhang & Zhang, 2021 by the general shape of the embolus and tegulum with a clearly outlined distal edge (Fig. 3) and similar body colouration (Fig. 7) and the female with a similar-shaped poreplate plate. However, <i>L. liz</i> sp. nov. can be distinguished by the male with curved subtegulum (Fig. 2) [vs. subtegulum straight in <i>L. nabang</i> (see Yu et al. (2021), figs. 3A and B)] and tibial apophysis almost as high as wide (Fig. 4) [vs. wider than high in <i>L. nabang</i> (see Yu et al. (2021), figs. 3 D-F)]. Females of the new species can be distinguished from those of <i>L. nabang</i> by the straight genital atrium (Figs 5, 6) [vs. genital atrium curved in <i>L. nabang</i> (see Yu et al. (2021), fig. 4)], posterior stalk and poreplate are located in the same plane (Figs 5, 6) [vs. posterior stalk perpendicular to poreplate in <i>L. nabang</i> (see Yu et al. (2021), fig. 4)] and posterior stalk two times longer than wide [vs. posterior stalk four times longer than wide in <i>L. nabang</i> (see Yu et al. (2021), fig. 4)].</p> <p>Etymology</p> <p>The specific name refers to the short name for the Laboratory of Invertebrate Zoology (LIZ), Institute of Zoology, Chinese Academy of Sciences in Beijing; noun in apposition. LIZ was founded by Shen Jia-Rui (see Dai (1997)) in 1928, later led by Daxiang Song (see Marusik (2008)) from 1975 to 1995 and has been led by the senior author Shuqiang Li from 1995 to the present.</p> <p>Distribution</p> <p>China (Yunnan; Fig. 8).</p> <p>DNA barcode</p> <p>CTGCGATGGTTATATTCAACAAATCACAAAGATATTGGAACTATATATTTAATTTTTGGTGTATGATCTGCCATAATCGGAACTGCACTAAGATTATTAATTCGAGCAGAATTAGGTCAACCAGGAAGATTAATCGGAGACGATCAAACATATAATGTAATTGTAACAGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCTATAATAATTGGAGGTTTTGGAAATTGATTAATCCCTCTTATACTAAGAGCCCCTGATATAGCTTTTCCTCGATTAAATAATTTAAGATTTTGATTATTACCCCCCTCTATCACCCTCTTATTGATTTCATCCATAGTAGAAAGAGGCTCCGGCACAGGTTGGACTATTTATCCCCCTATTGCTAGCATAGAATTTCACCCTGGTATATCTATTGATTATACTATTTTTTCATTACACCTTGCCGGGGCCTCTTCAATCTTAGGCGCAATTAATTTTATTACCACTATTATTAACATACGACCAAGAGGTATATTAATAGAGCGAGTACCATTATTTGTTTGATCTATTCTTATTACCGCAAGCCTACTGTTACTATCTTTACCTGTATTAGCTGGTGCGATTACTATGCTATTAACAGATCGAAATTTTAACACGTCATTTTTTGATCCAGCAGGAGGTGGTGACCCTATCCTATTCCAACATTTATTTTGATTTTTTGGTCATCCAGAAGTTTACATTCTTATTATTCCAGGTTTTGGGATAATTTCACATATTGTAAGACACAACGCTGGAAAAAAAGAACCTTTTGGGTCTTTAGGCATAATTTATGCAATATCCGCTATTGGATTACTAGGGTTTGTAGTCTGAGCACACCATATATTTACAGTAGGTATAGATGTTGATACACGAGCTTATTTCACAGCAGCAACCATAATTATTGCAATCCCCACAGGAATTAAAATTTTTAGATGATTAGCTACTCTTCATGGTACTAATTTAATCATAAGTACTTCCCTAATATGGTCTATTGGATTTATCTTCCTATTCACTATTGGTGGATTAACAGGCGTAATCCTAGCTAATTCATCTATTGATATTGTTCTTCATGATACATACTATGTAGTAGCTCATTTTCATTATGTTTTATCAATAGGAGCAGTTTTTGCAATTATAGCAAGAATTATTCACTGATTCCCTTTATTTTTTGGATTTTCATTTAATCAAACTTTATTAAAAATTAACTTTTTTTCCATATTTATTGGTGTAAATATAACCTTTTTCCCACAACACTTCTTAGGATTAAATGGAATACCACGACGATATTCAGATTACCCTGATATATTTATATCATGAAATGTAATTTCATCTTTAGGAAGAATTTTATCTTTTCTAGCAGTAATTATATTTATTTTAATTGTATGAGAAAGAATTATATCGAACCGTAATATTTATATTCCTACTCAATCACCTTCTTCAGTTGAATGAACTCAAAATATTCCTCCTTCTAATCATACCTTTAATCAACTCAATATACTCATTTTCTAA (GenBank accession number OR721885).</p> <p>Compared material examined</p> <p> <i>Liphistius nabang</i>: Holotype: ♂ (MHBU-ARA-00020000), CHINA, Yunnan Province, Dehong Dai and Jingpo Autonomous Prefecture, Yingjiang County, Nabang Town, 24.7521°N, 97.563°E, 265 m elev., 2 August 2019, leg. Quanyu Ji.</p> <p>Variation</p> <p>Vulvae of two paratype females, see Fig. 6.</p>Published as part of <i>Lin, Yejie & Li, Shuqiang, 2023, A new species of Liphistius Schiodte, 1849 (Araneae, Liphistiidae) from Yunnan, China, pp. 113290 in Biodiversity Data Journal 11</i> on page 113290, DOI: 10.3897/BDJ.11.e11329
CONSERVED FUNCTIONAL DOMAINS OF THE RNA-POLYMERASE-III GENERAL TRANSCRIPTION FACTOR BRF
No full textIn Saccharomyces cerevisiae, two components of the RNA polymerase III (Pol III) general transcription factor TFIIIB are the TATA-binding protein (TBP) and the B-related factor (BRF), so called because its amino-terminal half is homologous to the Pol II transcription factor IIB (TFIIB). We have cloned BRF genes from the yeasts Kluyveromyces lactis and Candida albicans, Despite the large evolutionary distance between these species and S. cerevisiae, the BRF proteins are conserved highly. Although the homology is most pronounced in the amino-terminal half, conserved regions also exist in the carboxy-terminal half that is unique to BRF. By assaying for interactions between BRF and other Pol III transcription factors, we show that it is able to bind to the 135-kD subunit of TFIIIC and also to TBP. Surprisingly, in addition to binding the TFIIB-homologous amino-terminal portion of BRF, TBP also interacts strongly with the carboxy-terminal half. Deleting two conserved regions in the BRF carboxy-terminal region abrogates this interaction. furthermore, TBP mutations that selectively inhibit Pol III transcription in vivo impair interactions between TBP and the BRF carboxy-terminal domain. Finally, we demonstrate that BRF but not TFIIB binds the Pol III subunit C34 and we define a region of C34 necessary for this interaction. These observations provide insights into the roles performed by BRF in Pol III transcription complex assembly
Anoplophora ankangensis Lin & Lingafelter 2018, comb. nov.
No full textAnoplophora ankangensis (Chiang, 1981) comb. nov. (Figs 5–9) Paranamera ankangensis Chiang, 1981: 82, 84, pl. 1, fig. 10. TL: China, Shaanxi. TD: NWAFU. Paranamera ankangensis: Chiang et al., 1985: 134, pl. IX, fig. 152; Löbl & Smetana, 2010: 284; Lin, 2017: 338, pl. 29, fig. 8. Diagnosis (Lin, 2017). This species is similar to Anoplophora elegans (Gahan, 1888) (Lingafelter & Hoebeke, 2002: 77, pl. 8, fig. a) but without annular pubescence at the apex of each antennomere. It is similar to A. stanleyana Hope, 1839 (Lingafelter & Hoebeke, 2002: 217, pl. 31, figs. d, e, f) and A. birmanica Hüdepohl, 1990 (Lingafelter & Hoebeke, 2002: 80, pl. 10, fig. a), but the yellowish pubescent markings on the pronotum terminate near the middle prothoracic lateral tubercles and lack such yellow pubescence at the basal half. Compared with A. horsfieldii (Hope, 1842) (Lingafelter & Hoebeke, 2002: 86, pl. 13, figs. a, b), the pronotal yellow pubescent markings are larger and only at the apical half, and the yellow elytral pubescent markings have five transverse lines instead of four. Specimens examined. China: 1 female, paratype, Shaanxi, Ankang, host: Prunus persica (Linnaeus) Batsch, 1960 (NWAFU, ex entomological collection of Shaanxi Forestrial Research Institute); 1 male, Shaanxi, Xunyang, 1981. VIII.27, leg. Fangfang She, Congde Lu (NWAFU, CO025460); 1 female, Shaanxi, Xunyang, 1981.VIII, leg. Congde Lu (NWAFU, CO027073); 1 female, Hunan, Hupingshan, Xiangbizigou, 2005. VII.20, leg. Zhao & Li (CBWX). Distribution. China: Henan, Shaanxi, Hunan (new Province record). Host plants ( Chiang, 1981; Tavakilian & Chevillotte, 2018 ). Prunus persica (Linnaeus) Batsch (Rosaceae). Remarks. The holotype is a female from Shaanxi, Ankang, collected in 1960.VII and was deposited in Northwestern Agriculture college (Chiang, 1981). It should be deposited in NWAFU, but the first author did not find the holotype in the main collection of NWAFU during her visit in 2017. It could be in another collection hosted by the Agriculture College (personal communication with Lin Lü, 2017. III.30). Fortunately she found the paratype female, which is also from Shaanxi, Ankang (reported in the Chinese description but missing in the English summary by Chiang, 1981), which indicated that the entomological collection of Shaanxi Forestry Research Institute is deposited in NWAFU. Specimen of Paranamera malaccensis Breuning, 1935 examined. Malaysia: 1 male, Sabah, Crocker Range, vic. Trus Madi, 2000. III.18, leg. Local collector (DJHC). Our examination of the type species of Paranamera Breuning, 1935, P. malaccensis Breuning, 1935, shows that it lacks the common features present in Anoplophora. It lacks a posteromedial pronotal callus (present in most Anoplophora and P. ankangensis Chiang, 1981), it has narrow-based lateral pronotal tubercles that are elevated apically (broad-based lateral pronotal tubercles that are not or very weakly elevated apically are present in most Anoplophora species and P. ankangensis), the scape is cylindrical with a reduced cicatrix and as long as the third antennomere (the scape is enlarged apically with a pronounced cicatrix and distinctly shorter than the third antennomere in Anoplophora and P. ankangensis), the sutural elytral apex is sub-spiniform or acute (rounded apically in Anoplophora and P. ankangensis), and the body is nearly uniformly covered in pubescence (distinct glabrous regions are present in Anoplophora species and P. ankangensis). One additional feature, a strongly emarginate labrum that is present in species of Paranamera (and mentioned in the original description of the genus by Breuning (1935), was the basis for placing P. ankangensis in that genus by Chiang (1981). In most Anoplophora the labrum is shallowly emarginate medially. However, this character is variable among and within species (Lingafelter & Hoebeke, 2002) and should not be used as a basis to exclude P. ankangensis from Anoplophora. Therefore, based on these features, Paranamera ankangensis Chiang, 1981 is transferred to Anoplophora as a new combination. The genus Paranamera Breuning, 1935 now includes three species: P. malaccensis Breuning, 1935 (Malaysia, Malacca, Penang), P. excisa Breuning, 1942 (Indonesia, West Sumatra) and P. oculata Hüdepohl, 1994 (Myanmar, Tenasserim; Thailand, Pak, Chong). We consider that the species P. oculata Hüdepohl, 1994 may need to be transferred from this genus due to its different pronotum and elytral apices, however, we reserve that decision for future study.Published as part of Lin, Mei-Ying & Lingafelter, Steven W., 2018, Taxonomic notes on Chinese Lamiini (Coleoptera: Cerambycidae: Lamiinae), pp. 367-374 in Zootaxa 4482 (2) on pages 370-372, DOI: 10.11646/zootaxa.4482.2.8, http://zenodo.org/record/144065
Generalized Abstracted Mean Values
No full textIn this article, the author introduces the generalized abstracted mean values which extend the concepts of most means with two variables, and researches their basic properties and monotonicities
The type II poly(A)-binding protein PABP-2 is a downstream target of the "let-7" microRNA in the heterochronic pathway of "Caenorhabditis elegans" : mechanisms of microRNA-mediated gene silencing in "Caenorhabditis elegans"
No full textmicroRNAs (miRNAs) are a large class of small, non-coding RNAs that post-transcriptionally regulate gene expression in animals, plants and protozoa. miRNAs are genomically encoded and transcribed by RNA polymerase II. Primary transcripts are sequentially processed by two RNase III enzymes via short, approximately 70 nucleotide long stem-loop containing precursor miRNAs into mature 21 to 23 nucleotide long miRNAs. Mature miRNAs are incorporated into the miRNA-induced silencing complex (miRISC), which, in its core, consists of an Argonaute and a GW182 family protein. miRNAs serve as guide molecules to direct miRISC to target mRNAs. Typically, miRNAs interact by base-pairing with partially complementary miRNA binding sites located in the 3’ untranslated regions of the targeted mRNA. Binding of miRISC ultimately prevents protein accumulation by mechanisms which are not well understood. miRNAs regulate diverse biological processes including development, proliferation, differentiation, apoptosis, host defense, and cancer. By estimation, miRNAs potentially regulate more than 60% of the human protein coding genome, leaving only few, if any, genetic pathway untouched.
The phylogenetically conserved miRNA lethal-7 (let-7) was first discovered as an essential developmental gene in the heterochronic pathway of the free-living nematode Caenorhabditis elegans. The genes of the heterochronic pathway direct the stage specific execution of cell fates during post-embryonic development of C. elegans.
We identified the type II poly(A)-binding protein PABP-2 in a suppressor screen for let-7 loss-of-function lethality. Mammalian PABP2 was initially identified as an enhancer of nuclear polyadenylation. In this work we show that depletion of PABP-2 not only rescues loss of let-7 function, but also causes let-7 gain-of-function phenotypes in wild-type animals. Surprisingly, efficient depletion of PABP-2 leaves global translation and mRNA levels largely unaffected, but causes premature accumulation of the LIN-29 transcription factor, the most downstream factor known in the heterochronic pathway. This is not due to an effect on let-7 biogenesis and let-7 activity, which are not affected by the level of PABP-2. However, we find that PABP�2 protein levels are developmentally regulated and decrease during larval development. Although PABP-2 is unlikely to be a direct target of let-7, decrease of PABP-2 in late larval development depends, at least in part, on let-7 activity.
The molecular mechanism of miRNA-mediated gene silencing has been subject to intense debate. Despite a plethora of often conflicting data, the emerging consensus is that repression of translation initiation and accelerated mRNA degradation are the prevailing mechanisms. However, it is not clear whether translational repression and mRNA degradation constitute two parallel mechanisms or whether translational repression and mRNA degradation are sequential events. Work done in our lab showed, that in C. elegans, miRNAs regulate their cognate target genes by repression of translation at the initiation stage, which often, but not always, coincides with reduced target mRNA levels. Furthermore, repression depended on the presence of AIN-1 and AIN-2, the C. elegans homologs of the GW182 protein family. AIN-1 and AIN-2 are highly divergent homologs of fly and vertebrate GW182 proteins. Moreover, AIN-1 and AIN-2 show only little similarity at the level of their protein sequences. In an extension of our previous work, we studied the individual contribution of AIN-1 and AIN-2 to miRNA mediated gene silencing by analyzing ain-1 and ain-2 single mutant animals. We find that translational repression, but not mRNA decay, relies on the presence of AIN-1. However, overexpression of AIN-2 rescues ain-1 specific developmental defects and restores wild-type translational repression. It is not clear why translational repression and mRNA degradation have a different requirement for overall GW182 protein levels. Thus far, our data proof that AIN-1 as well as AIN-2 act as bona fide GW182 proteins, mediating both translational repression and mRNA decay
Reconsidering Gender and Investment in the Intrahousehold Decision-Making Process
No full textIn the very recent past, the economics of the household and the economics of development appear to be edging toward a new convergence of concern around the nature and use of assets. However, these two literatures of economics continue to exist in separate spheres. I draw from both bodies of literature in order to examine gender differences in asset portfolios. I find systematic differences in the way that certain assets held by husbands versus wives influence household decision outcomes. A clear understanding of the nature and functions of various types of assets in hands of husbands and wives is necessary to better understand the gendered impacts of economic and social institutions in developing countries
Recommended from our members
Centering Chicago Public Schools’ Portfolio Strategy on Racial Equity, Students & Community through Organizational Learning & Innovation
No full textIn 2013, the massive closure of 50 Chicago Public Schools bred community mistrust, harmed students academically, and left abandoned school buildings as relics of community divestments. With current declining enrollment and the need for accelerated learning, there is an urgent call to examine the district’s portfolio of schools and ensure every Chicago neighborhood has high-quality, well-resourced school programming for 330,000 students. Moreover, there is a vital need to take a different approach to manage the district’s portfolio of schools that strengthens the community, improves learning for students, and establishes greater trust among students and families.
In the capstone, I elevate two different small-scale innovations – one focused on improving the current portfolio approach and another focused on introducing a radical schema to disrupt the traditional portfolio approach. The capstone describes a liberatory design approach to co-create and implement both innovations. While each small-scale innovation had varying success amid leadership transitions, organizational learning is key to centering the portfolio approach around racial equity, community responsiveness, and student experience.
The capstone outlines potential implications for me as a leader, Chicago Public Schools as the site, and the PreK-12 education sector. Chicago Public Schools acknowledges that a portfolio approach for all schools must include racial equity, community responsiveness, and student experience. The district is on a path to make significant strides to redefine the traditional portfolio model to restore community trust and reimagine effective school options for all Chicago Public Schools students
- …
