3,514 research outputs found
Appropriate Similarity Measures for Author Cocitation Analysis
No full textWe provide a number of new insights into the methodological discussion about author cocitation analysis. We first argue that the use of the Pearson correlation for measuring the similarity between authors’ cocitation profiles is not very satisfactory. We then discuss what kind of similarity measures may be used as an alternative to the Pearson correlation. We consider three similarity measures in particular. One is the well-known cosine. The other two similarity measures have not been used before in the bibliometric literature. Finally, we show by means of an example that our findings have a high practical relevance.information science;Pearson correlation;cosine;similarity measure;author cocitation analysis
Liphistius liz Lin & Li 2023, sp. nov.
No full text<p>Liphistius liz Lin & Li, 2023 sp. nov.</p> <p>Materials</p> <p> <b>Type status:</b> Holotype. <b>Occurrence:</b> catalogNumber: IZCAS-Ar44748; recordedBy: Yicheng Lin; individualCount: 1; sex: male; lifeStage: adult; occurrenceID: 5BCC41FF-4DC2-53C5-836F-F9BBC80D4BDE; <b>Taxon:</b> scientificName: Liphistius liz; <b>Location:</b> country: China; stateProvince: Yunnan; county: Lianghe; locality: Jiubao Achang Township, Shizunao; verbatimElevation: 1200 m; decimalLatitude: 24.7478; decimalLongitude: 98.2106; <b>Identification:</b> identifiedBy: Yejie Lin; dateIdentified: 2023; <b>Event:</b> year: 2023; month: 5; day: 13 <b>Type status:</b> Paratype. <b>Occurrence:</b> catalogNumber: IZCAS-Ar44749; recordedBy: Yicheng Lin; individualCount: 1; sex: female; lifeStage: adult; occurrenceID: 2177DB32-CFCD-5FED-9AAF-D1629797C869; <b>Taxon:</b> scientificName: Liphistius liz; <b>Location:</b> country: China; stateProvince: Yunnan; county: Lianghe; locality: Jiubao Achang Township, Shizunao; verbatimElevation: 1200 m; decimalLatitude: 24.7478; decimalLongitude: 98.2106; <b>Identification:</b> identifiedBy: Yejie Lin; dateIdentified: 2023; <b>Event:</b> year: 2023; month: 8; day: 12 <b>Type status:</b> Paratype. <b>Occurrence:</b> catalogNumber: IZCAS-Ar44750; recordedBy: Yicheng Lin; individualCount: 1; sex: female; lifeStage: adult; occurrenceID: 4FEE7ED6-6BCF-50BB-A7A5-D3C318237341; <b>Taxon:</b> scientificName: Liphistius liz; <b>Location:</b> country: China; stateProvince: Yunnan; county: Lianghe; locality: Jiubao Achang Township, Shizunao; verbatimElevation: 1200 m; decimalLatitude: 24.7478; decimalLongitude: 98.2106; <b>Identification:</b> identifiedBy: Yejie Lin; dateIdentified: 2023; <b>Event:</b> year: 2023; month: 8; day: 12 <b>Type status:</b> Paratype. <b>Occurrence:</b> catalogNumber: IZCAS-Ar44751; recordedBy: Yicheng Lin; individualCount: 1; sex: female; lifeStage: adult; occurrenceID: 34FCBAD1-1985-59EA-8784-A3605859BC42; <b>Taxon:</b> scientificName: Liphistius liz; <b>Location:</b> country: China; stateProvince: Yunnan; county: Lianghe; locality: Jiubao Achang Township, Shizunao; verbatimElevation: 1200 m; decimalLatitude: 24.7478; decimalLongitude: 98.2106; <b>Identification:</b> identifiedBy: Yejie Lin; dateIdentified: 2023; <b>Event:</b> year: 2023; month: 8; day: 12 <b>Type status:</b> Paratype. <b>Occurrence:</b> catalogNumber: IZCAS-Ar44752; recordedBy: Yicheng Lin; individualCount: 1; sex: female; lifeStage: adult; occurrenceID: BB3338CB-0A61-516F-BEA2-1CA2A06BA8E9; <b>Taxon:</b> scientificName: Liphistius liz; <b>Location:</b> country: China; stateProvince: Yunnan; county: Lianghe; locality: Jiubao Achang Township, Shizunao; verbatimElevation: 1200 m; decimalLatitude: 24.7478; decimalLongitude: 98.2106; <b>Identification:</b> identifiedBy: Yejie Lin; dateIdentified: 2023; <b>Event:</b> year: 2023; month: 8; day: 12</p> <p>Description</p> <p>Male (holotype, Figs 2, 3 b, 4, 7 A). Total length 7.55. Carapace 4.19 long and 3.83 wide, earthy yellow in ethanol (slightly lighter than in life), margin and fovea colour darker, without obvious dark stripes between coxal elevations (Fig. 7 A). Eye sizes and interdistances: AME 0.06, ALE 0.49, PME 0.25, PLE 0.35, AME-AME 0.08, AME-ALE 0.08, PME-PME 0.04, PME-PLE 0.06, AME-PME 0.02, ALE-PLE 0.05. Chelicerae reduced, brown, with several short macrosetae. Labium 0.73 long and 0.44 wide, fused with sternum. Sternum 1.98 long and 0.75 wide, posterior tip elongated. Opisthosoma 3.54 long and 2.29 wide, with ten tergites. Leg measurements: leg I 11.86 (3.26, 3.85, 3.17, 1.58), leg II 13.46 (3.83, 4.07, 3.51, 2.05), leg III 14.88 (3.53, 4.30, 4.47, 2.58), leg IV 19.41 (4.69, 5.51, 5.91, 3.30).</p> <p>Palp (Figs 2, 3 b, 4). Tibial apophysis of palp almost as high as wide, situated near retrolateral margin of tibia, with four megaspines. Cymbium with two clavate trichobothria retrolaterally (Fig. 4 D). Paracymbium large and thick, almost as wide as cymbium, cumulus distinctly elevated with many long setae (Fig. 4). Subtegulum curved in prolaterodorsal and ventral views, without obvious apophysis. Tegulum with a well-developed and denticulate distal edge. Half of the contrategulum strongly sclerotised, with a ventral process (Figs 2, 3 b). Paraembolic plate slightly elevated. Embolus partly sclerotised, with some longitudinal ridges extending to the tip, margins of these ridges slightly dentated (Figs 2, 3 b).</p> <p>Female (paratype, Figs 1, 5, 7 B). Total length 10.32. Carapace 4.87 long, 4.16 wide, colour as in males, except shades being darker (Figs 1, 7 B). Eye sizes and interdistances: AME 0.06, ALE 0.45, PME 0.27, PLE 0.31, AME-AME 0.06, AME-ALE 0.07, PME-PME 0.04, PME-PLE 0.05, AME-PME 0.04, ALE-PLE 0.05. Chelicerae robust, reddish-brown, with a few short stripes on dorsal side and several long macrosetae on retrolateral edge of fang groove. Labium 1.03 long, 0.52 wide. Sternum 242 long, 1.23 wide. Opisthosoma 5.92 long, 4.52 wide, with ten tergites. Leg measurements: leg I 8.60 (3.04, 2.77, 1.75, 1.04), leg II 8.63 (2.68, 3.16, 1.65, 1.14), leg III 9.80 (2.98, 3.14, 2.28, 1.48), leg IV 14.34 (3.93, 4.47, 3.83, 2.11).</p> <p>Vulva (Fig. 5): Poreplate with four notobvious protuberances (two anterolateral and two posterolateral), two posterolateral protuberances not attached to ventral rim of poreplate. Central dorsal opening globular, receptacular cluster grape-shaped. Bulging margins on ventral poreplate only extending to the posterolateral corner of poreplate (Fig. 5 B) and distance between bulging margins almost as wide as poreplate. Genital atrium straight. Posterior area of posterior stalk located in the same plane of poreplate and almost as wide as poreplate (Fig. 5 A).</p> <p>Diagnosis</p> <p> Males of the new species resemble <i>Liphistius nabang</i> Yu, Zhang & Zhang, 2021 by the general shape of the embolus and tegulum with a clearly outlined distal edge (Fig. 3) and similar body colouration (Fig. 7) and the female with a similar-shaped poreplate plate. However, <i>L. liz</i> sp. nov. can be distinguished by the male with curved subtegulum (Fig. 2) [vs. subtegulum straight in <i>L. nabang</i> (see Yu et al. (2021), figs. 3A and B)] and tibial apophysis almost as high as wide (Fig. 4) [vs. wider than high in <i>L. nabang</i> (see Yu et al. (2021), figs. 3 D-F)]. Females of the new species can be distinguished from those of <i>L. nabang</i> by the straight genital atrium (Figs 5, 6) [vs. genital atrium curved in <i>L. nabang</i> (see Yu et al. (2021), fig. 4)], posterior stalk and poreplate are located in the same plane (Figs 5, 6) [vs. posterior stalk perpendicular to poreplate in <i>L. nabang</i> (see Yu et al. (2021), fig. 4)] and posterior stalk two times longer than wide [vs. posterior stalk four times longer than wide in <i>L. nabang</i> (see Yu et al. (2021), fig. 4)].</p> <p>Etymology</p> <p>The specific name refers to the short name for the Laboratory of Invertebrate Zoology (LIZ), Institute of Zoology, Chinese Academy of Sciences in Beijing; noun in apposition. LIZ was founded by Shen Jia-Rui (see Dai (1997)) in 1928, later led by Daxiang Song (see Marusik (2008)) from 1975 to 1995 and has been led by the senior author Shuqiang Li from 1995 to the present.</p> <p>Distribution</p> <p>China (Yunnan; Fig. 8).</p> <p>DNA barcode</p> <p>CTGCGATGGTTATATTCAACAAATCACAAAGATATTGGAACTATATATTTAATTTTTGGTGTATGATCTGCCATAATCGGAACTGCACTAAGATTATTAATTCGAGCAGAATTAGGTCAACCAGGAAGATTAATCGGAGACGATCAAACATATAATGTAATTGTAACAGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCTATAATAATTGGAGGTTTTGGAAATTGATTAATCCCTCTTATACTAAGAGCCCCTGATATAGCTTTTCCTCGATTAAATAATTTAAGATTTTGATTATTACCCCCCTCTATCACCCTCTTATTGATTTCATCCATAGTAGAAAGAGGCTCCGGCACAGGTTGGACTATTTATCCCCCTATTGCTAGCATAGAATTTCACCCTGGTATATCTATTGATTATACTATTTTTTCATTACACCTTGCCGGGGCCTCTTCAATCTTAGGCGCAATTAATTTTATTACCACTATTATTAACATACGACCAAGAGGTATATTAATAGAGCGAGTACCATTATTTGTTTGATCTATTCTTATTACCGCAAGCCTACTGTTACTATCTTTACCTGTATTAGCTGGTGCGATTACTATGCTATTAACAGATCGAAATTTTAACACGTCATTTTTTGATCCAGCAGGAGGTGGTGACCCTATCCTATTCCAACATTTATTTTGATTTTTTGGTCATCCAGAAGTTTACATTCTTATTATTCCAGGTTTTGGGATAATTTCACATATTGTAAGACACAACGCTGGAAAAAAAGAACCTTTTGGGTCTTTAGGCATAATTTATGCAATATCCGCTATTGGATTACTAGGGTTTGTAGTCTGAGCACACCATATATTTACAGTAGGTATAGATGTTGATACACGAGCTTATTTCACAGCAGCAACCATAATTATTGCAATCCCCACAGGAATTAAAATTTTTAGATGATTAGCTACTCTTCATGGTACTAATTTAATCATAAGTACTTCCCTAATATGGTCTATTGGATTTATCTTCCTATTCACTATTGGTGGATTAACAGGCGTAATCCTAGCTAATTCATCTATTGATATTGTTCTTCATGATACATACTATGTAGTAGCTCATTTTCATTATGTTTTATCAATAGGAGCAGTTTTTGCAATTATAGCAAGAATTATTCACTGATTCCCTTTATTTTTTGGATTTTCATTTAATCAAACTTTATTAAAAATTAACTTTTTTTCCATATTTATTGGTGTAAATATAACCTTTTTCCCACAACACTTCTTAGGATTAAATGGAATACCACGACGATATTCAGATTACCCTGATATATTTATATCATGAAATGTAATTTCATCTTTAGGAAGAATTTTATCTTTTCTAGCAGTAATTATATTTATTTTAATTGTATGAGAAAGAATTATATCGAACCGTAATATTTATATTCCTACTCAATCACCTTCTTCAGTTGAATGAACTCAAAATATTCCTCCTTCTAATCATACCTTTAATCAACTCAATATACTCATTTTCTAA (GenBank accession number OR721885).</p> <p>Compared material examined</p> <p> <i>Liphistius nabang</i>: Holotype: ♂ (MHBU-ARA-00020000), CHINA, Yunnan Province, Dehong Dai and Jingpo Autonomous Prefecture, Yingjiang County, Nabang Town, 24.7521°N, 97.563°E, 265 m elev., 2 August 2019, leg. Quanyu Ji.</p> <p>Variation</p> <p>Vulvae of two paratype females, see Fig. 6.</p>Published as part of <i>Lin, Yejie & Li, Shuqiang, 2023, A new species of Liphistius Schiodte, 1849 (Araneae, Liphistiidae) from Yunnan, China, pp. 113290 in Biodiversity Data Journal 11</i> on page 113290, DOI: 10.3897/BDJ.11.e11329
Vascular endothelial growth factor restores delayed tumor progression in tumors depleted of macrophages
No full textGenetic depletion of macrophages in Polyoma Middle T oncoprotein (PyMT)-induced mammary tumors in mice delayed the angiogenic switch and the progression to malignancy. To determine whether vascular endothelial growth factor A (VEGF-A) produced by tumor-associated macrophages regulated the onset of the angiogenic switch, a genetic approach was used to restore expression of VEGF-A into tumors at the benign stages. This stimulated formation of a high-density vessel network and in macrophage-depleted mice, was followed by accelerated tumor progression. The expression of VEGF-A led to a massive infiltration into the tumor of leukocytes that were mostly macrophages. This study suggests that macrophage-produced VEGF regulates malignant progression through stimulating tumor angiogenesis, leukocytic infiltration and tumor cell invasion
Relations between acoustic and articulatory measurements of /l/
No full textVariation in the production of English /l/ has received significant study. It has been characterized in terms of categorical allophones, in terms of acoustic properties, and in terms of articulatory timing. Using a parallel corpus of acoustic-articulatory data from two speakers of American English, this study looks at the relations between acoustic and articulatory measurements of /l/ across words in corpus of read speech. We find significant negative correlations between F1 and tongue tip height and significant positive correlations between F2 and tongue body retraction. Additionally, we find that the relative timing of tongue tip and tongue back gestures in our data are consistent with past work on positional variants of /l/
[[alternative]]Application of critical concepts, anaerobic power and energy expenditure in predicting rowing performance
No full text[[abstract]]Application of critical concepts, anaerobic power and energy expenditure in predicting rowing performance
June,2005 Hsin-Fu Lin
Advisor: Jung-Charng Lin,
Abstract
Critical velocity (CV) and critical power (CP) have been proposed to be effective indirect anaerobic threshold methods in monitoring training and predicting performance of rowing respectively. The purpose of this study was to compare these two indexes in predicting indoor rowing performance by combining different physiological variables, including maximal oxygen uptake ( VO2max ), anaerobic threshold (AT4) and modified Wingate test, which are important physiological variables in endurance performance. In addition, whether or not the physiological variables (VO2, VCO2, VE, HR, [La-]) under these two critical intensities were stable was also examined. Fifteen elite female rowers (age 20.73± 1.44 years, height 1.64 ±0.35m, weight 56.64±4.38kg) were recruited in this study. VO2max (2.47 ±0.47L) and AT4(157.81 ±22.08W) were measured during a discontinuous graded exercise test, starting at 100W, on a Concept II ergometer increased by 25 W for each 3-min stage. Four test times of duration 90s, 240s, 600s, and 1200s were used to determine CP (139.49 ±20.37W), whereas CV( 4.00 ±0.14m/s) was estimated by 400m, 600m, 800m, 1000m maximal exertion trials in different days as well by using Linear distance-time model. Peak power (353.48 ±27.71W), maximum power (350.12 ±26.72W), minimum power (336.85 ±21.58W), mean power (314.44 ±27.87W), fatigue index (max power - min power/ mean power) were obtained using a modified Wingate test protocol (30s sprint) on the ergometer. Physiological variation of intensity at CV and CP, including VO2, VCO2, VE, HR, [La-], were measured every 5 minutes in 20-min constant rowing tests. The results of study showed that VO2max, AT4, CP, CV, peak power, mean power were significantly correlated with 2000 indoor rowing performance (r=?0.84, ?0.85, ?0.81, ?0.97, ?0.66, ?0.67, P<0.01). By submitting mean power, fatigue index, VO2max, AT4 with each index to a stepwise regression analysis, it produced two individual critical concept models as following to predict 2000 indoor rowing performance: CV model: T2000= ?131.83 CV(m/s)?1.00 fatugue index(%) +1023.91 (R2=0.96, SEE=4.10, p<.05); CP model: T2000=?22.59 VO2max(L/min)?.38AT4(W)+608.58 (R2 =0.82, SEE=8.05, p<.05). When rowing at CV on indoor ergometer (14±4 min), VO2, VE, HR, [La-] didn’t reach steady state and VCO2 was not different at different time points. Under CP, VO2, VCO2 didn’t change with time, however, there were significant difference of VE, HR, [La-] at different time points. Our findings in this study indicated that CV has more predictive power, representing as anaerobic threshold, than AT4 to predict rowing performance. Besides CV, fatigue index from modified Wingate test is also an important determinant for 2000-m performance of female rowers. Therefore, comparing with CP, CV could be used when applying critical concept in training and evaluate indoor performance in rowing. In addition, both two-parameter-derived CV and CP in rowing do not represent sustainable steady state intensities.
Key words: critical velocity, critical power, anaerobic power, energy expenditure, rowing, performance.
The design of a radio altimeter using frequency modulation method
No full textThesis (M.S.)--Massachusetts Institute of Technology, Dept. of Electrical Engineering, 1937 [second author], and Thesis (M.S.)--Massachusetts Institute of Technology, Dept. of Aeronautical Engineering, 1937 [first author].MICROFICHE COPY AVAILABLE IN ENGINEERING.Includes bibliographical references (leaves 108-110).by Shih-Nge Lin, Ieu-Liang Wu.M.S
Impacts of fixed orthodontic appliance and clear-aligner on daily performance in adult patients with moderate need for treatment [Retraction]
No full textLin F, Yao L, Bhikoo C, Guo J. Impacts of fixed orthodontic appliance and clear-aligner on daily performance in adult patients with moderate need for treatment. Patient Preference and Adherence. 2016;10:1639–1645.The corresponding author Dr Jing Guo, was not aware that his/her name had been used and did not give permission for the paper to be published. In addition, there were serious errors in the statistical tests used. This retraction relates to this paper 
Comment on Chen and Lin “Does downloading Powerpoint slides before the lecture lead to better student achievement?â€
No full textChen and Lin (2008) is an interesting attempt to measure the effect of students having access to PowerPoint slides before a lecture. They argue that such access leads to better learning outcomes as measured by higher exam marks. While their empirical results shed some light on students’ use of PowerPoint slides, I argue that they have not succeeded in isolating the treatment effect and the correlations cannot be interpreted as causal.
Neotypification and taxonomic status of Opephyllum martensii Schmitz in Schmitz et Hauptfleisch (Delesseriaceae, Rhodophyta) from Zamboanga, Southern Philippines
No full textThe monotypic delesseriaceous genus Opephyllum was created by Schmitz in Schmitz and Hauptfleisch for O. martensii, represented by a single collection from Zamboanga on the southwestern tip of Mindanao in the southern Philippines. As the type specimen or collection is no longer in existence, we are neotypifying the taxon based on recent topotype collections made in the spring of 1998. After comparison of this material with species of Martensia from the Indo-Pacific region and Caribbean Sea based on morphological evidence and sequence analysis of chloroplast-encoded rbcL and the nuclear-encoded large subunit ribosomal DNA gene (LSU rDNA), we conclude that Opephyllum is not generically distinct from Martensia despite its lack of the reticulate fenestrations that characterize fronds of every other species of the latter. We therefore propose the new combination Martensia martensii (Schmitz in Schmitz et Hauptfleisch) Lin, Fredericq et Liao for this rare member of the tribe Martensieae, subfamily Nitophylloideae.TR: CS0213352Source type: Electronic(1
Data corresponding to "The Impact of Multi-sensor Land Data Assimilation on River Discharge Estimation"
No full textThis dataset is corresponding to the input and output files that were used in this study:
Wu, W.-Y., Z.-L. Yang, L. Zhao, P. Lin (2022), Joint Multi-sensor Data Assimilation for Constraining Water Storages and its Impact on Global Discharge Estimation (in revision, RSE)Please contact the author when using this dataset for publication
- …
