4,071 research outputs found
Liphistius liz Lin & Li 2023, sp. nov.
No full text<p>Liphistius liz Lin & Li, 2023 sp. nov.</p> <p>Materials</p> <p> <b>Type status:</b> Holotype. <b>Occurrence:</b> catalogNumber: IZCAS-Ar44748; recordedBy: Yicheng Lin; individualCount: 1; sex: male; lifeStage: adult; occurrenceID: 5BCC41FF-4DC2-53C5-836F-F9BBC80D4BDE; <b>Taxon:</b> scientificName: Liphistius liz; <b>Location:</b> country: China; stateProvince: Yunnan; county: Lianghe; locality: Jiubao Achang Township, Shizunao; verbatimElevation: 1200 m; decimalLatitude: 24.7478; decimalLongitude: 98.2106; <b>Identification:</b> identifiedBy: Yejie Lin; dateIdentified: 2023; <b>Event:</b> year: 2023; month: 5; day: 13 <b>Type status:</b> Paratype. <b>Occurrence:</b> catalogNumber: IZCAS-Ar44749; recordedBy: Yicheng Lin; individualCount: 1; sex: female; lifeStage: adult; occurrenceID: 2177DB32-CFCD-5FED-9AAF-D1629797C869; <b>Taxon:</b> scientificName: Liphistius liz; <b>Location:</b> country: China; stateProvince: Yunnan; county: Lianghe; locality: Jiubao Achang Township, Shizunao; verbatimElevation: 1200 m; decimalLatitude: 24.7478; decimalLongitude: 98.2106; <b>Identification:</b> identifiedBy: Yejie Lin; dateIdentified: 2023; <b>Event:</b> year: 2023; month: 8; day: 12 <b>Type status:</b> Paratype. <b>Occurrence:</b> catalogNumber: IZCAS-Ar44750; recordedBy: Yicheng Lin; individualCount: 1; sex: female; lifeStage: adult; occurrenceID: 4FEE7ED6-6BCF-50BB-A7A5-D3C318237341; <b>Taxon:</b> scientificName: Liphistius liz; <b>Location:</b> country: China; stateProvince: Yunnan; county: Lianghe; locality: Jiubao Achang Township, Shizunao; verbatimElevation: 1200 m; decimalLatitude: 24.7478; decimalLongitude: 98.2106; <b>Identification:</b> identifiedBy: Yejie Lin; dateIdentified: 2023; <b>Event:</b> year: 2023; month: 8; day: 12 <b>Type status:</b> Paratype. <b>Occurrence:</b> catalogNumber: IZCAS-Ar44751; recordedBy: Yicheng Lin; individualCount: 1; sex: female; lifeStage: adult; occurrenceID: 34FCBAD1-1985-59EA-8784-A3605859BC42; <b>Taxon:</b> scientificName: Liphistius liz; <b>Location:</b> country: China; stateProvince: Yunnan; county: Lianghe; locality: Jiubao Achang Township, Shizunao; verbatimElevation: 1200 m; decimalLatitude: 24.7478; decimalLongitude: 98.2106; <b>Identification:</b> identifiedBy: Yejie Lin; dateIdentified: 2023; <b>Event:</b> year: 2023; month: 8; day: 12 <b>Type status:</b> Paratype. <b>Occurrence:</b> catalogNumber: IZCAS-Ar44752; recordedBy: Yicheng Lin; individualCount: 1; sex: female; lifeStage: adult; occurrenceID: BB3338CB-0A61-516F-BEA2-1CA2A06BA8E9; <b>Taxon:</b> scientificName: Liphistius liz; <b>Location:</b> country: China; stateProvince: Yunnan; county: Lianghe; locality: Jiubao Achang Township, Shizunao; verbatimElevation: 1200 m; decimalLatitude: 24.7478; decimalLongitude: 98.2106; <b>Identification:</b> identifiedBy: Yejie Lin; dateIdentified: 2023; <b>Event:</b> year: 2023; month: 8; day: 12</p> <p>Description</p> <p>Male (holotype, Figs 2, 3 b, 4, 7 A). Total length 7.55. Carapace 4.19 long and 3.83 wide, earthy yellow in ethanol (slightly lighter than in life), margin and fovea colour darker, without obvious dark stripes between coxal elevations (Fig. 7 A). Eye sizes and interdistances: AME 0.06, ALE 0.49, PME 0.25, PLE 0.35, AME-AME 0.08, AME-ALE 0.08, PME-PME 0.04, PME-PLE 0.06, AME-PME 0.02, ALE-PLE 0.05. Chelicerae reduced, brown, with several short macrosetae. Labium 0.73 long and 0.44 wide, fused with sternum. Sternum 1.98 long and 0.75 wide, posterior tip elongated. Opisthosoma 3.54 long and 2.29 wide, with ten tergites. Leg measurements: leg I 11.86 (3.26, 3.85, 3.17, 1.58), leg II 13.46 (3.83, 4.07, 3.51, 2.05), leg III 14.88 (3.53, 4.30, 4.47, 2.58), leg IV 19.41 (4.69, 5.51, 5.91, 3.30).</p> <p>Palp (Figs 2, 3 b, 4). Tibial apophysis of palp almost as high as wide, situated near retrolateral margin of tibia, with four megaspines. Cymbium with two clavate trichobothria retrolaterally (Fig. 4 D). Paracymbium large and thick, almost as wide as cymbium, cumulus distinctly elevated with many long setae (Fig. 4). Subtegulum curved in prolaterodorsal and ventral views, without obvious apophysis. Tegulum with a well-developed and denticulate distal edge. Half of the contrategulum strongly sclerotised, with a ventral process (Figs 2, 3 b). Paraembolic plate slightly elevated. Embolus partly sclerotised, with some longitudinal ridges extending to the tip, margins of these ridges slightly dentated (Figs 2, 3 b).</p> <p>Female (paratype, Figs 1, 5, 7 B). Total length 10.32. Carapace 4.87 long, 4.16 wide, colour as in males, except shades being darker (Figs 1, 7 B). Eye sizes and interdistances: AME 0.06, ALE 0.45, PME 0.27, PLE 0.31, AME-AME 0.06, AME-ALE 0.07, PME-PME 0.04, PME-PLE 0.05, AME-PME 0.04, ALE-PLE 0.05. Chelicerae robust, reddish-brown, with a few short stripes on dorsal side and several long macrosetae on retrolateral edge of fang groove. Labium 1.03 long, 0.52 wide. Sternum 242 long, 1.23 wide. Opisthosoma 5.92 long, 4.52 wide, with ten tergites. Leg measurements: leg I 8.60 (3.04, 2.77, 1.75, 1.04), leg II 8.63 (2.68, 3.16, 1.65, 1.14), leg III 9.80 (2.98, 3.14, 2.28, 1.48), leg IV 14.34 (3.93, 4.47, 3.83, 2.11).</p> <p>Vulva (Fig. 5): Poreplate with four notobvious protuberances (two anterolateral and two posterolateral), two posterolateral protuberances not attached to ventral rim of poreplate. Central dorsal opening globular, receptacular cluster grape-shaped. Bulging margins on ventral poreplate only extending to the posterolateral corner of poreplate (Fig. 5 B) and distance between bulging margins almost as wide as poreplate. Genital atrium straight. Posterior area of posterior stalk located in the same plane of poreplate and almost as wide as poreplate (Fig. 5 A).</p> <p>Diagnosis</p> <p> Males of the new species resemble <i>Liphistius nabang</i> Yu, Zhang & Zhang, 2021 by the general shape of the embolus and tegulum with a clearly outlined distal edge (Fig. 3) and similar body colouration (Fig. 7) and the female with a similar-shaped poreplate plate. However, <i>L. liz</i> sp. nov. can be distinguished by the male with curved subtegulum (Fig. 2) [vs. subtegulum straight in <i>L. nabang</i> (see Yu et al. (2021), figs. 3A and B)] and tibial apophysis almost as high as wide (Fig. 4) [vs. wider than high in <i>L. nabang</i> (see Yu et al. (2021), figs. 3 D-F)]. Females of the new species can be distinguished from those of <i>L. nabang</i> by the straight genital atrium (Figs 5, 6) [vs. genital atrium curved in <i>L. nabang</i> (see Yu et al. (2021), fig. 4)], posterior stalk and poreplate are located in the same plane (Figs 5, 6) [vs. posterior stalk perpendicular to poreplate in <i>L. nabang</i> (see Yu et al. (2021), fig. 4)] and posterior stalk two times longer than wide [vs. posterior stalk four times longer than wide in <i>L. nabang</i> (see Yu et al. (2021), fig. 4)].</p> <p>Etymology</p> <p>The specific name refers to the short name for the Laboratory of Invertebrate Zoology (LIZ), Institute of Zoology, Chinese Academy of Sciences in Beijing; noun in apposition. LIZ was founded by Shen Jia-Rui (see Dai (1997)) in 1928, later led by Daxiang Song (see Marusik (2008)) from 1975 to 1995 and has been led by the senior author Shuqiang Li from 1995 to the present.</p> <p>Distribution</p> <p>China (Yunnan; Fig. 8).</p> <p>DNA barcode</p> <p>CTGCGATGGTTATATTCAACAAATCACAAAGATATTGGAACTATATATTTAATTTTTGGTGTATGATCTGCCATAATCGGAACTGCACTAAGATTATTAATTCGAGCAGAATTAGGTCAACCAGGAAGATTAATCGGAGACGATCAAACATATAATGTAATTGTAACAGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCTATAATAATTGGAGGTTTTGGAAATTGATTAATCCCTCTTATACTAAGAGCCCCTGATATAGCTTTTCCTCGATTAAATAATTTAAGATTTTGATTATTACCCCCCTCTATCACCCTCTTATTGATTTCATCCATAGTAGAAAGAGGCTCCGGCACAGGTTGGACTATTTATCCCCCTATTGCTAGCATAGAATTTCACCCTGGTATATCTATTGATTATACTATTTTTTCATTACACCTTGCCGGGGCCTCTTCAATCTTAGGCGCAATTAATTTTATTACCACTATTATTAACATACGACCAAGAGGTATATTAATAGAGCGAGTACCATTATTTGTTTGATCTATTCTTATTACCGCAAGCCTACTGTTACTATCTTTACCTGTATTAGCTGGTGCGATTACTATGCTATTAACAGATCGAAATTTTAACACGTCATTTTTTGATCCAGCAGGAGGTGGTGACCCTATCCTATTCCAACATTTATTTTGATTTTTTGGTCATCCAGAAGTTTACATTCTTATTATTCCAGGTTTTGGGATAATTTCACATATTGTAAGACACAACGCTGGAAAAAAAGAACCTTTTGGGTCTTTAGGCATAATTTATGCAATATCCGCTATTGGATTACTAGGGTTTGTAGTCTGAGCACACCATATATTTACAGTAGGTATAGATGTTGATACACGAGCTTATTTCACAGCAGCAACCATAATTATTGCAATCCCCACAGGAATTAAAATTTTTAGATGATTAGCTACTCTTCATGGTACTAATTTAATCATAAGTACTTCCCTAATATGGTCTATTGGATTTATCTTCCTATTCACTATTGGTGGATTAACAGGCGTAATCCTAGCTAATTCATCTATTGATATTGTTCTTCATGATACATACTATGTAGTAGCTCATTTTCATTATGTTTTATCAATAGGAGCAGTTTTTGCAATTATAGCAAGAATTATTCACTGATTCCCTTTATTTTTTGGATTTTCATTTAATCAAACTTTATTAAAAATTAACTTTTTTTCCATATTTATTGGTGTAAATATAACCTTTTTCCCACAACACTTCTTAGGATTAAATGGAATACCACGACGATATTCAGATTACCCTGATATATTTATATCATGAAATGTAATTTCATCTTTAGGAAGAATTTTATCTTTTCTAGCAGTAATTATATTTATTTTAATTGTATGAGAAAGAATTATATCGAACCGTAATATTTATATTCCTACTCAATCACCTTCTTCAGTTGAATGAACTCAAAATATTCCTCCTTCTAATCATACCTTTAATCAACTCAATATACTCATTTTCTAA (GenBank accession number OR721885).</p> <p>Compared material examined</p> <p> <i>Liphistius nabang</i>: Holotype: ♂ (MHBU-ARA-00020000), CHINA, Yunnan Province, Dehong Dai and Jingpo Autonomous Prefecture, Yingjiang County, Nabang Town, 24.7521°N, 97.563°E, 265 m elev., 2 August 2019, leg. Quanyu Ji.</p> <p>Variation</p> <p>Vulvae of two paratype females, see Fig. 6.</p>Published as part of <i>Lin, Yejie & Li, Shuqiang, 2023, A new species of Liphistius Schiodte, 1849 (Araneae, Liphistiidae) from Yunnan, China, pp. 113290 in Biodiversity Data Journal 11</i> on page 113290, DOI: 10.3897/BDJ.11.e11329
Meotipa luoqiae Lin & Li 2021, sp. nov.
No full textMeotipa luoqiae Lin & Li, sp. nov. (Figs 47A–C, 48A–B, 53G–H) Diagnosis. The new species is similar to M. spiniventris (O. Pickard-Cambridge, 1869) but can be distinguished by the presence of 2 distal spines on the opisthosoma (vs. 4 distal spines in M. spiniventris), 2 conductor apophysis, and the straight Sp in ventral view (vs. curved in M. spiniventris). Description. Male (holotype, IZCAS-Ar42467, Figs 47A–C, 48A–B, 53G–H). Total length 2.65. Prosoma 0.93 long, 0.83 wide, pale yellow, flat. Sternum 0.50 long, 0.50 wide, pale yellow. Opisthosoma 0.93 long, 0.83 wide, pale yellow, with large white and tiny dark spots; with 2 strong spines on distal part. Eyes developed: AME 0.09, ALE 0.08, PME 0.09, PLE 0.08, AME–AME 0.09, AME–ALE 0.06, PME–PME 0.09, PME–PLE 0.06. Clypeus height about 3.33 times AME diameter. Chelicerae with 1 promarginal tooth, retromarginal tooth absent. Leg I femur 2.65, patella 0.45, tibia 2.15, metatarsus 2.75, tarsus 0.85. Patella and tibia II–IV: 1.60, 0.85, 1.75. Leg I pale yellow, femur with a disto-ventral spine; patella with a distodorsal spine; tibia with 2 dorsal spines. Legs II–IV same as leg I in spination. Palp (Figs 47A–C, 48A–B) patella with a strong spine; tibia with a strong retrolateral spine; Sp linear in ventral view; C coiled at end, with 3 small outgrowths; E with 2 apophyses at middle. Female. Unknown. Material examined. Holotype ♂, China: Yunnan, Menglun Nature Reserve (21.9589°N, 101.2050°E; elev. ca. 816 m), 4 August 2007, leg. Guo Zheng (IZCAS-Ar42467). Paratype. 1♂ (IZCAS-Ar42468), same data as holotype. Distribution. Only known from type locality. Etymology. The species name is honoring the Chinese rock singer Mrs. Qi Luo, which encouraged the author by her courage, freedom and spirit of exploration; noun (name) in apposition. Variation. Male (paratype). Total length 2.05–2.65; prosoma 0.88–0.93 long, 0.73–0.83 wide; sternum 0.50–0.55 long, 0.44–0.50 wide; opisthosoma 0.93–1.13 long, 0.63–0.83 wide.Published as part of Lin, Yejie, Marusik, Yuri M., Gao, Caixia, Xu, Hao, Zhang, Xiaoqing, Wang, Ziyi, Zhu, Wenhui & Li, Shuqiang, 2021, Twenty-three new spider species (Arachnida: Araneae) from Asia, pp. 91-152 in Zoological Systematics 46 (2) on page 146, DOI: 10.11865/zs.2021201, http://zenodo.org/record/536706
DEVELOPMENT OF COBALT-FREE HIGH ENERGY DENSITY POSITIVE ELECTRODE MATERIALS FOR LI-ION BATTERIES
No full textThe positive electrode constitutes a key component of the Li-ion cell and helps determine the energy density and cost of the cell. Co-rich positive electrode active materials have been widely commercialized, with proven success, and maintain a reliable performance record across markets. And yet, due to economic reasons and ethical concerns, Li-ion manufacturers are turning to Co- free, Ni-rich materials. But eliminating Co is not without its drawbacks. Co-free, Ni-rich materials can deliver high capacity; they can also deliver long lifetime. However, it has been challenging to design materials that can deliver both simultaneously. Besides the fact that electrode materials with both high capacity and long lifetime are more attractive to consumers, they also provide an environmentally sustainable solution. Using higher energy density materials reduces the size of the cell or the number of cells needed to make battery systems. Increasing the lifetime of the cell extends the period until the cell needs to be disposed of or recycled and reduces the rate at which critical metals need to be mined and treated to make new cells.
This work extensively examines the effects of Al and W in LiNi1-xMnxO2 (NM) systems and optimizes the material to increase both the gravimetric capacity and cycle life of the cell. Since Ni- rich materials are susceptible to reactions with water, the materials are characterized thoroughly with a focus on the surface’s sensitivity to moisture and washing. Furthermore, this work demonstrates that greater attention needs to be paid to the mechanical properties of the material particles to identify, in a time-efficient manner, the propensity of the material to crack and, in turn, better understand the degradation mechanisms of the electrode. When studying Ni-rich materials, the safety of the material is also of interest; the thermal stability of the materials at a high state of charge were characterized and reported in this work. Through these methods, Co-free, Ni-rich materials were designed with high energy density and impressive charge-discharge capacity retention
Episinus bonjovi Lin & Li 2021, sp. nov.
No full textEpisinus bonjovi Lin & Li, sp. nov. (Figs 38A–C, 39A–B, 40A–D, 53A–B) Diagnosis. The new species is similar to E. unitus Levi, 1964, but it can be distinguished by the larger atrium, the nephroid S, the conspicuous CD, and the medially curved FDs. Description. Male (holotype, IZCAS-Ar42451, Figs 38A–C, 40C–D, 53A). Total length 2.10. Prosoma 0.88 long, 0.68 wide, flat, pale yellow, with a broad reddish brown stripe at middle, anterior part of ocular area with two distinct processes. Sternum 0.41 long, 0.38 wide, pale yellow. Opisthosoma 1.13 long, 1.13 wide, pale yellow, with 3 protuberances and white spots. Eyes developed: AME 0.09, ALE 0.05, PME 0.06, PLE 0.06, AME–AME 0.06, AME–ALE 0.02, PME–PME 0.06, PME–PLE 0.03. Clypeus height about 1.64 times AME diameter. Leg I femur 1.55, patella 0.30, tibia 1.33, metatarsus 1.30, tarsus 0.63. Patella and tibia II–IV: 0.88, 0.63, 0.88. Legs pale yellow, tip of femur IV and base of patella reddish brown. Palp (Figs 38A–C, 40C–D). ST confined; Sp distinct in ventral view; E long and slender; TTA with tiny tubes and 2 acute protuberances; C huge. Female (paratypes, IZCAS-Ar42455, Figs 39A–B, 40A–B, 53B). Total length 3.63. Prosoma 1.03 long, 0.94 wide, flat, pale yellow, with a broad reddish brown stripe at middle, anterior part of ocular area with 2 distinct processes. Sternum 0.61 long, 0.46 wide, pale yellow. Opisthosoma 2.42 long, 3.12 wide, brown or pale, with tiny white spots and 3 protuberances. Eyes developed. Epigynum (Figs 39A–B, 40A–B). Atrium large; S nephroid; CD strong sclerotized; FDs bent at middle. Material examined. Holotype ♂, China: Yunnan, Menglun Nature Reserve (21.9588°N, 101.2064°E; elev. ca. 899 m), 6 August 2007, leg. Guo Zheng (IZCAS-Ar42451). Paratypes. 3♂ (IZCAS-Ar42452–Ar42454), 3♀ (IZCAS-Ar42455– Ar42457), same data as holotype. Distribution. Known only from the type locality. Etymology. The species name is honoring the American rock band Bon Jovi, composer of the music album "Have a Nice Day" and the singles "Because We Can" and "Living On A Prayer", which encouraged the author by their songs full of romance and freedom; noun (name) in apposition. Variation. Male (paratypes; n = 3). Total length 1.88–1.93; prosoma 0.68–0.72 long, 0.63–0.65 wide; sternum 0.35–0.38 long, 0.30–0.38 wide; opisthosoma 1.13–1.18 long, 1.13–1.18 wide. Female (paratypes; n = 3). Total length 3.25–3.75. Prosoma 1.00–1.10 long, 0.90–1.00 wide, Sternum 0.60–0.65 long, 0.48–0.50 wide, pale yellow. Opisthosoma 2.25–2.65 long, 3.00–3.25 wide.Published as part of Lin, Yejie, Marusik, Yuri M., Gao, Caixia, Xu, Hao, Zhang, Xiaoqing, Wang, Ziyi, Zhu, Wenhui & Li, Shuqiang, 2021, Twenty-three new spider species (Arachnida: Araneae) from Asia, pp. 91-152 in Zoological Systematics 46 (2) on pages 135-138, DOI: 10.11865/zs.2021201, http://zenodo.org/record/536706
Media literacy of government leaders in the e-government era
No full textWith the development of globalization and information technology, the process of government management is become more and more digital. E-government has become an inevitable choice of public management, leading to the high demand for media literacy of government leaders. Leaders should not only have high levels of professional ability and moral quality, but also need excellent media literacy to spread the latest thoughts of government leadership. Media literacy of government leaders includes three parts: network governance (NG), propaganda on party building and regulate the network of democracy. Based on the investigation of current government leaders' media literacy, the author finds that government leaders' media literacy still needs to be further improved. This paper provides the following recommendations: (1) adhering to people-oriented ideology, (2) perfecting the training and appointive mechanism of government leaders, (3)combine government leaders' media literacy with human resource management process (e.g. selection, recruitment, performance evaluation), (4)strengthen the party's construction and management of media
Fabbisogni energetici per edifici caratterizzanti il terziario in Italia: aspetti termici ed illuminotecnici
No full textIl presente lavoro verte sull'individuazione di benchmark di fabbisogno energetico per edifici di riferimento con destinazione d'uso non-residenziale. In particolare, si intende fornire profili tipo di domanda energetica per l'illuminazione artificiale, al fine di valutarne l'effetto sui profili di fabbisogno di energia per la climatizzazione estiva ed invernale, nonché di individuare le variabili che maggiormente incidono sulla loro determinazione. Per giungere a questi risultati, ci si avvale dell'uso di programmi informatici di simulazione dinamica riconosciuti ed impiegati a livello scientifico, in ambito europeo ed extraeuropeo (Energy Plus). La ricerca viene condotta sotto vari aspetti: architettonico, energetico e ambientale. Il primo obiettivo, partendo dalle indicazioni bibliografiche, legislative e normative, è quello di caratterizzare in modo univoco gli edifici di riferimento per le varie destinazioni d'uso oggetto di analisi: edifici per l'istruzione, ed edifici terziari. Gli edifici di riferimento intendono costituire archetipi rappresentativi del patrimonio edilizio italiano. Il secondo obiettivo è di tipo energetico: si intende definire profili tipo di domanda energetica per l'illuminazione artificiale degli ambienti. Si intendono inoltre valutare contestualmente i fabbisogni energetici netti per il riscaldamento e il raffrescamento degli ambienti. L'obiettivo finale è riuscire a determinare le migliori soluzioni progettuali per la minimizzazione del fabbisogno di energia connesso all'illuminazione, in relazione alle destinazioni d'uso dei differenti edifici, nonché le variabili che più incidono per indirizzare al meglio le attenzioni progettuali in caso di nuova realizzazione. Il presente lavoro, dopo un primo inquadramento generale in cui si delinea quello che è lo stato dell'arte della valutazione dei fabbisogni energetici e della ricerca scientifica in materia di illuminazione artificiale di ambienti non residenziali, passa poi ad indagare il significato di archetipo e a definire degli archetipi edilizi per il patrimonio immobiliare costruito a destinazione d'uso scolastica e terziaria. Successivamente vengono descritti i modelli di calcolo impiegati e sono dettagliati i dati di input impiegati per la loro definizione. Sono infine esplicati i risultati ottenuti, con individuazione dei valori di benchmark energetico per gli archetipi edilizi scolastici e terziari, e con l'analisi di quelle che sono le grandezze maggiormente influenti sul fabbisogno energetico per illuminazion
Fu hun he re ba- nie- lin jin shu bo li zhong de xuan jie xian fen jie
No full textWu, Zhenduo = 負混合熱鈀-鎳-磷金屬玻璃中的旋節線分解 / 吳楨舵.Thesis Ph.D. Chinese University of Hong Kong 2015.Includes bibliographical references.Abstracts also in Chinese.Title from PDF title page (viewed on 09, December, 2016).Wu, Zhenduo = Fu hun he re ba- nie- lin jin shu bo li zhong de xuan jie xian fen jie / Wu Zhenduo
[[alternative]]The Representation of Style:On Lin Yutang’s Translation of Six Chapters of the Floating Life
No full text[[abstract]]This thesis aims at exploring how the style of Six Chapters of the Floating Life is represented in Lin Yutang’s translation. Style means distinctive characteristics of one’s writing, such as one’s choice of diction, sentence structures, images, etc. Parallel structures and vivid images give Six Chapters of the Floating Life an elegant style. This thesis is divided into four chapters. Chapter One “Lin Yutang and Six Chapters of the Floating Life” includes the introduction to Six Chapters of the Floating Life, that to Lin Yutang’s translation of the book, and the summary of some scholars’ evaluation of Lin’s translation. Chapter Two “The Evaluation of the Translation of Sentence Structures in Lin’s Version” explores Lin’s translation of parallel structures and compound sentences. Chapter Three “The Evaluation of the Translation of Figures of Speech in Lin’s Version” discusses Lin’s translation of metaphors, of antitheses and of images. Chapter Four “The Comparison of Lin’s Translation and Another Two Translations of Six Chapters of the Floating Life” analyzes the similarities and differences of these three translations in order to have a better understanding of Lin’s translation strategies.
Psychometric Evaluation of the Chinese Version of the Theory of Mind Inventory for Children With Autism Spectrum Disorder
No full textAbstract
Date Presented 4/1/2017
This study developed a Chinese version of the Theory of Mind Inventory (ToMI–C) for assessing theory of mind (ToM) performance in children with autism spectrum disorder (ASD) in actual social contexts. The ToMI–C will facilitate the evaluation of the ToM of Taiwanese children with ASD accurately.
Primary Author and Speaker: Dai-Rong Jiang
Additional Authors and Speakers: Kuan-Lin Chen
Contributing Authors: Chien-Ho Lin, Li-Chen Tung, Ya-Chen Lee</jats:p
- …
