323,188 research outputs found
Molecular characterization of cucumber mosaic virus isolates infecting ornamental species cultivated in the botanical garden of Bologna university.
No full textDuring an epidemiological survey carried out in the Botanical Garden at Bologna University, Cucumber mosaic virus (CMV) has been detected by applying PAS-ELISA technique infecting some ornamental species exhibiting a severe symptomatology on the leaves. Datura innoxia Miller. showed mosaic and leaf-curling; Globularia nudicaulis L. produced narrowed leaves with a yellow mosaic and/or variegation; Eupatorium cannabinum L. showed a systemic chlorotic and/or yellow mosaic and stunting. Reverse transcription-polymerase chain reaction (RT-PCR) and single strand conformation polymorphism (SSCP) were employed to characterise these CMV isolates. Total RNA was extracted from symptomatic leaf samples with a Qiagen RNeasy Plant Minikit (Qiagen S.P.A., Milan, Italy) according to the manufacturer’s instructions. RT-PCR was carried out using specific primers for the movement protein gene of RNA3 of CMV (forward MP+ CATGGCTTTCCAAGGTACCAG, genomic position 118nt to 138nt, and reverse CTAAAGACCGTTAACCACCTGC, genomic position 938nt to 959nt). All samples from the three ornamental species, yielded DNA fragments of the expected size: 841 bp. PCR products were then analysed by SSCP to identify specific sequence variants and compare genetic relationships with CMV isolates from other ornamental species present in the same Botanical Garden (Thevetia nereifolia and Nandina domestica) (1). The results showed a different sequence variant for each CMV isolate, indicating that these tree isolates are a new accession in the Botanical Garden. Probably these isolates came from the original Country of the plants.
1) Davino et al., 2005. Cucumber mosaic virus infecting Thevetia nereifolia Juss. ex Stedu. and Nandina domestica Thumb. J. Plant Path., 87(4), 292-293
First report of Tomato leaf curl New Delhi virus affecting zucchini squash in an important horticultural area of southern Italy
No full textomato leaf curl New Delhi virus (ToLCNDV) is a bipartite begomovirus (family Geminiviridae) which infects species in the families Cucurbitaceae and Solanaceae (Padidam et al., 1995; Mizutani et al., 2011). Begomoviruses are transmitted by the whitefly Bemisia tabaci in a persistent manner (Rosen et al., 2015). In October 2015, severe symptoms not previously reported by growers in the horticultural area of the Province of Trapani (Sicily, Italy) were observed on zucchini squash (Cucurbita pepo) in open fields. The symptoms included yellow mosaic, severe leaf curling, swelling of veins of young leaves, shortening of internodes, roughness of the skin of fruit and reduced fruit size; the symptoms were reminiscent of those caused by begomoviruses. Total DNA was extracted from young leaves of 22 plants by phenol/chloroform extraction and ethanol precipitation. PCR was performed with the A1F/A1R primer pair (Mizutani et al., 2011) for the DNA-A component and the pair described by Ruiz et al. (2015) for the DNA-B component to amplify a ~1200-bp fragment of DNA-A and a ~890 bp fragment of DNA-B, respectively. All 10 samples were positive by PCR with both primer pairs. No amplification products were obtained using primers specific for the monopartite begomoviruses Tomato yellow leaf curl virus and Tomato yellow leaf curl Sardinia virus (Davino et al., 2008). DAS-ELISA analysis for Cucumber mosaic virus, Papaya ring spot virus and Zucchini yellow mosaic virus (Loewe Phytodiagnostica, Germany) yielded negative results
First Report of Tomato Brown Rugose Fruit Virus on Tomato Crops in Italy
No full textIn October 2018, virus-like symptoms were observed in four different greenhouses of tomato (Solanum lycopersicum) in Ragusa province (Sicily, Italy). Symptoms consisted in mosaic, deformation, and necrosis on young leaves, and discoloration and deformations on young fruits. In total 40 symptomatic samples were collected (10 for each greenhouse). Samples were tested by reverse transcription polymerase chain reaction (RT-PCR) using specific primers for different viruses that incite similar symptoms on tomato plants: Groundnut ringspot virus (Camelo-García et al. 2014), Parietaria mottle virus (Galipienso et al. 2015), Pepino mosaic virus (Panno et al. 2012), Tobacco etch virus (Zhang et al. 2012), Tomato brown rugose fruit virus (Salem et al. 2015), Tomato chlorotic spot virus (Webster et al. 2013), Tomato mosaic virus (Panno et al. 2012), Tomato mottle mosaic virus (Sui et al. 2017), Tomato necrotic spot virus (Bratsch et al. 2018), Tomato necrotic streak virus (Badillo-Vargas et al. 2016), Tomato torrado virus (Panno et al. 2012), and Tomato yellow leaf curl virus (Davino et al. 2008). Thirty-seven out of the 40 samples analyzed yielded fragments of the expected size only for tomato brown rugose fruit virus (ToBRFV). This screening identified ToBRFV as a putative causal agent of this disease. To confirm the presence of this virus, two new primers named ToBRFV-F-5722, 5′-CACAATCGCAACTCCATCGC-3′ (coordinates: 5,722 to 5,742 nt referred to GenBank no. KT383474), and ToBRFV-R-6179, 5′-CAGAGGACCATTGTAAACCGG-3′ (coordinates: 6,179 to 6,200 nt referred to GenBank no. KT383474), based on the sequence of the coat protein gene, were designed. RT-PCR, in one-step format, was performed in 25 μl (final volume) containing 2 μl of total RNA, 20 mM Tris-HCl (pH 8.4), 50 mM KCl, 3 mM MgCl2, 0.4 mM dNTPs, 1 mM of primers, 4U of RNaseOut, 20 U of superscript II reverse transcription-RNaseH, and 2U of Taq DNA polymerase (Thermo Fisher, U.S.A.). RT-PCR was carried out according to the following conditions: 42°C for 45 min; 95°C for 5 min; 40 cycles of 30 s at 95°C, 30 s at 55°C, and 30 s at 72°C; and a final elongation of 10 min at 72°C. The RT-PCR yielded the expected amplicons of 458 bp, confirming the previous results. The amplification products were purified using the UltraClean PCR Clean-Up kit (Mo-Bio, U.S.A.), and the nucleotide sequences were determined in both directions using an ABI PRISM 3100 DNA sequence analyzer (Applied Biosystems, U.S.A.). The sequences obtained from the 37 samples showed 99% identity. BLAST analysis showed an identity >99% with ToBRFV isolates Tom1-Jo (accession no. KT383474) and ToBRFV-IL (accession no. KX619418). Only one sequence was deposited in GenBank (accession no. MK313803). Sap extracts of four samples retrieved from the four different greenhouses were mechanically inoculated into tomato cultivar Marmande (three plants per isolate). Plants were grown in sterilized soil in an insect-proof glasshouse, with a photoperiod of 14 h light at 28/20°C day/night. Symptoms were recorded weekly, with all plants showing the symptoms described for ToBRFV at 30 days postinoculation. Tomato brown rugose fruit virus is a single-stranded positive RNA virus, belonging to the genus Tobamovirus, family Virgaviridae (Salem et al. 2015). Sicily is an important region for horticulture in Southern Europe. This virus represents a serious problem for tomato crops in Sicily and in all regions where tomato is grown, owing to its ability to be transmitted by plant-to-plant contact, by manipulations, and particularly by seeds. To our knowledge, this is the first report of ToBRFV in Italy and in Southern Europe
Inula viscosa L. a new host of Cucumber mosaic virus
No full textInula viscosa L. (Asteraceae) is a well-known perennial medicinal herb that grows wild in the Mediterranean area. Both folk and traditional medicines ascribe several uses to this plant, such as antipyretic, antiseptic, etc. In Spring 2007, almost 40% of I. viscosa plants cultivated at the Herb Garden “Augusto Rinaldi Ceroni “ of Casola Valsenio (Emilia Romagna, Italy) showed chlorotic mosaic on leaves. Symptomatic samples were collected and analysed. No spherical or elongated virus-like particles were observed by transmission electron microscopy in leaf extracts using a leaf dip method. By applying PAS-ELISA technique, Cucumber mosaic virus alone was detected in all symptomatic plants (more than 20) tested, using a polyclonal antiserum (PVAS 30, American Type Culture Collection, Manassas, VA, USA). CMV from I. viscosa leaves was mechanically transmitted to Nicotiana tabacum L. “Samsun”, which developed systemic mosaic symptoms. To confirm the association of CMV with the diseased plants, total RNA was extracted from the same samples (RNeasy Plant Mini Kit; Qiagen, Hilden, Germany) and analyzed by RT-PCR using CMV-specific primers MP+ and MP- (Lin et al., 2004). The expected 842 bp fragment was amplified only from samples of symptomatic tissue while no amplification product was observed when water or healthy plants were used as a template. RT-PCR products were cloned and sequenced. The sequence obtained (GenBank Accession No. EU432181) had 99% identity with CMV-TN (GenBank Accession No. AB176847) which induces tomato necrosis disease, and several other isolates of subgroup II. To our knowledge, this is the first report of CMV infecting I. viscosa and it adds a new host to the list of more than 1,000 species infected by this virus
Gravi malformazioni in melanzana in Sicilia associate alla presenza di fitoplasmi.
No full textStunting and leaf malformation were repeatedly observed during vegetative growth in eggplant cultivations located in Sicily (Ragusa). Symptoms appear during first weeks after transplantation, and modify normal shape of plants as well as decrease their production, in several cases stunting was present but only in half of the plant. The disease was scattered distributed in the fields and with percentages below 10%. Samples were collected from symptomatic and asymptomatic plants, and shoots and midribs were used for nucleic acid exstraction to verify possible phytoplasma presence and identity. Nested PCR assays with primers P1/P7 followed by R16mF1/R16mR1 (Gundersen and Lee, 1996) allow to obtain bands of the expected lenght, about 1,500 bp, only from symptomatic samples. Sequencing of one of the amplicons after purification with NucleoSpin kit (Macherey-Nagel) was obtained with primers R16mF1, R16mR1 and M1 (Gibb et al, 1995); a 1,379 bp sequence fully homologous to phytoplasma related to ‘Candidatus Phytoplasma aurantifolia’ was obtained, in particular the 16Sr sequence obtained was identical to the one described in cactus pear with malformation symptoms in Sicily (AY995133; Granata et al., 2006). Reamplification of positive samples with primers R16F2/R2 followed by RFLP analyses with TruI, Hpy8I and TaqI allow to classify the eggplant phytoplasma in the 16SrII-C subgroup. This is the fist identification of phytoplasmas of this subgroup in eggplant, the species is however quite susceptible to phytoplasma infection worldwide since these prokaryotes were identified in Bangladesh (16SrI), Turkey (16SrVI) and Brazil (16SrIII). In Southern Italy phytoplasma symptoms were described in eggplant and attributed to stolbur, however molecular identification was not carried out (Polizzi et al., 1990)
First report of Tomato torrado virus infecting tomato in Italy
No full text In 2009 and 2010, approximately 2% of plants had disease symptoms, including initial leaflet chlorosis that later developed into necrotic spots and general necroses along the leaflet. Fruit production on affected plants was substantially reduced and necroses were also present. Total RNA was extracted from five symptomatic plant samples using the RNeasy Plant Mini Kit (Qiagen, Hilden, Germany) and analyzed by reverse transcription (RT)-PCR with specific primer pair: TR2F (5′ GAAGGACGAAGAGCGACTG 3′), and TR2R (5′ AAGGTAGGTATGCGTTTGC 3′) (1). The primers amplified a 575-bp fragment within the coat protein Vp23 of Tomato torrado virus (ToTV). No RT-PCR products were observed when water or asymptomatic tomato plants were used as controls. The RT-PCR products were purified and directly sequenced in both directions. Pair-wise similarity analysis confirmed the presence of ToTV with 99% similarity to isolate PRI-ToTV0301 (GenBank Accession No. DQ388880) and 98% similarity to isolate Kra (Accession No. EU652402). A representative sequence was deposited with GenBank (Accession No. GU903899). To further confirm the presence of ToTV, dsRNA analysis was conducted on all five symptomatic plants and one healthy tomato plant (2). Electrophoresis of dsRNA showed two bands of approximately 5,400 and 7,800 nucleotides long, typical of ToTV in all samples, while a third band between the other two (approximately 6,400 nt) was detected. Serological testing using double-antibody sandwich-ELISA was also conducted on the five symptomatic and 25 additional plants from the same greenhouse that displayed typical Pepino mosaic virus (PepMV) symptoms only. Antibodies used for serological testing screened for the presence of PepMV, Tomato spotted wilt virus, Cucumber mosaic virus, and Tomato mosaic virus (Loewe Biochemica, Sauerlach, Germany). These tests detected PepMV in all samples with disease symptoms typical of PepMV, and in three of the five samples with the newly described symptoms. To our knowledge, this is the first report of ToTV in Italy, and in some plants, co-infection with PepMV was likely. All ToTV-infected tomato plants in the greenhouse were destroyed. References: (1) H. Pospieszny et al. Plant Dis. 91:1364, 2007. (2) J. Sambrook et al. Molecular Cloning. A Laboratory Manual. 2nd ed. Cold Spring Harbor Laboratory Press, Woodbury, NY, 1989. </jats:p
A single tube PCR assay for detecting viruses and their recombinants that cause tomato yellow leaf curl disease in Mediterranean basin.
No full textTomato yellow leaf curl disease (TYLCD) is well known in Mediterranean countries, where it has been causing severe losses in tomato crops for decades. Until recently, two viruses (with several isolates) in the genus Begomovirus, family Geminiviridae, have been associated with the epidemics: Tomato yellow leaf curl virus (TYLCV) and Tomato yellow leaf curl Sardinia virus (TYLCSV). However, recombinants between these, such as Tomato yellow leaf curl Malaga virus (TYLCMalV), are spreading, and new methods for detecting all viruses present in the region are needed. By considering all DNA sequences available of viruses causing TYLCD in the Mediterranean basin, a PCR/RFLP protocol was developed that amplifies the intergenic region in a multiplex reaction, followed by digestion with AclI (=Psp1406I) restriction enzyme. This procedure generates an easily recognizable pattern on gels, with DNA fragments of specific size for each virus species and each recombinant: 800 bp for TYLCSV, 410 bp for TYLCV, 570 bp for TYLCMalV and the other detected recombinants, 640 bp for hypothetical recombinants of different type. This new method gives, with a single reaction, an overview of the species present in the sample and will be useful for screening the causal agents of TYLCD, as well as in breeding programs for resistance
- …
