1,473 research outputs found
Some forgotten equilibria of the Bertrand duopoly!?
No full textThis note analyzes the Bertrand duopoly with constant but asymmetric marginal costs on a market with homogenous products. It is shown that there exist some equilibria that are ignored in the literature on IO. In addition, in this setting (perfectly or nearly perfectly) competitive equilibria exist.
Giraffa tippelskirchi subsp. tippelskirchi tippelskirchi Matschie 1898
No full textGiraffa tippelskirchi tippelskirchi Matschie, 1898 Giraffa schillingsi Matschie, 1898: 79. Diagnosis Stellate formed spots, shanks olive-coloured and spotted down to the hoofs, anterior horn less developed, one ES in the Cytb gene: 1033 C=>T. Distribution Southern Kenya, Tanzania.Published as part of Petzold, Alice, Magnant, Anne-Sophie, Edderai, David, Chardonnet, Bertrand, Rigoulet, Jacques, Saint-Jalme, Michel & Hassanin, Alexandre, 2020, First insights into past biodiversity of giraffes based on mitochondrial sequences from museum specimens, pp. 1-33 in European Journal of Taxonomy 703 on page 24, DOI: 10.5852/ejt.2020.703, http://zenodo.org/record/398966
Giraffa giraffa subsp. giraffa giraffa giraffa (Boddaert 1784
No full textGiraffa giraffa giraffa (Boddaert, 1784) Camelopardalis australis Swainson, 1835: 284. Camelopardalis capensis Lesson, 1842: 168. Camelopardalis maculata Weinland, 1863: 205, fig. p. 206. Giraffa camelopardalis angolensis Lydekker, 1903: 121, fig. p. 121. Diagnosis One ES in the Cytb gene: 798 T=>C; two ES in the CR: 130 iT, 170 A=>G. Distribution Angola, Botswana, Namibia, Zimbabwe.Published as part of Petzold, Alice, Magnant, Anne-Sophie, Edderai, David, Chardonnet, Bertrand, Rigoulet, Jacques, Saint-Jalme, Michel & Hassanin, Alexandre, 2020, First insights into past biodiversity of giraffes based on mitochondrial sequences from museum specimens, pp. 1-33 in European Journal of Taxonomy 703 on page 25, DOI: 10.5852/ejt.2020.703, http://zenodo.org/record/398966
Giraffa camelopardalis subsp. camelopardalis camelopardalis (Linnaeus 1758
No full textGiraffa camelopardalis camelopardalis (Linnaeus, 1758) Camelopardalis aethiopicus Ogilby, 1837: 134. Camelopardalis biturigum Duvernoy, 1844: 12, fig. 4. Giraffa camelopardalis typica Bryden, 1899: 489, plate XIV. Diagnosis Front of the face sparsely and sides fully spotted, similar pattern to reticulata but with chestnut or sandy patches. Past distribution Probably extinct, former range between the Blue Nile and Tekezé /Atbara rivers in southeastern Sudan (eastern Sennar) and northern Ethiopia (Abyssinia).Published as part of Petzold, Alice, Magnant, Anne-Sophie, Edderai, David, Chardonnet, Bertrand, Rigoulet, Jacques, Saint-Jalme, Michel & Hassanin, Alexandre, 2020, First insights into past biodiversity of giraffes based on mitochondrial sequences from museum specimens, pp. 1-33 in European Journal of Taxonomy 703 on page 22, DOI: 10.5852/ejt.2020.703, http://zenodo.org/record/398966
Giraffa tippelskirchi subsp. thornicrofti Lydekker 1911
No full textGiraffa tippelskirchi thornicrofti Lydekker, 1911 Diagnosis Low and conical anterior horn, grey colour and scattered spotting of the sides of the face, fawn shanks, three ES in the CR: 39 A=>G, 272 T=>C, 336 T=>A; two ES in the IGF2B1 intron: 60 C=>T, 304 G =>A. Type material Holotype ZAMBIA • 1 specimen (skin); Petauke district; NHMUK-1910.10.17.1. Distribution Luangwa Valley in Zambia.Published as part of Petzold, Alice, Magnant, Anne-Sophie, Edderai, David, Chardonnet, Bertrand, Rigoulet, Jacques, Saint-Jalme, Michel & Hassanin, Alexandre, 2020, First insights into past biodiversity of giraffes based on mitochondrial sequences from museum specimens, pp. 1-33 in European Journal of Taxonomy 703 on page 25, DOI: 10.5852/ejt.2020.703, http://zenodo.org/record/398966
Heterogeneous Behavioral Rules in the Oligopolistic Case
No full textIn a static symmetric duopoly the set of behavioral rules is extended to different types of markup pricing. Using an equilibrium concept suggested in Pasche (2001), it is shown that dependend on the markup neither pure Cournot nor pure Bertrand behavior is a behavioral equilibrium profile. Instead, there is a rationale for the usage of simple heuristics. The presence of markup rules leads to Stackelberg outcomes. Furthermore, pure markup behavior is more competitive than in Cournot case but less competitive than in Bertrand case. It is shown, that multiple behavioral equilibria and heterogeneous behavior may arise, where at least one player uses price setting strategies.oligopoly, markup rules, heterogeneity, behavioral equilibrium.
Giraffa camelopardalis subsp. senegalensis Petzold, Magnant & Hassanin 2020, subsp. nov.
No full textGiraffa camelopardalis senegalensis Petzold, Magnant & Hassanin, subsp. nov. urn:lsid:zoobank.org:act: 838C1DB1-59BA-49DD-B5AA-F5432F36B112 Diagnosis Beige ground colour covered with dark brown spots following a reticulated pattern separated by narrow lines, skull features detailed in Blainville (1864), one ES in the Cytb gene: 732 A=> G; four ES in the CR: 92 dC, 95 A=>G, 359 C =>T, 463 A=>G. Type material examined Holotype (here designated) SENEGAL • 1 specimen (skeleton); Bakel; MNHN-A10617. Past distribution Probably extinct, former range extended over Senegal (holotype) and potentially Gambia, Mauritania and Mali.Published as part of Petzold, Alice, Magnant, Anne-Sophie, Edderai, David, Chardonnet, Bertrand, Rigoulet, Jacques, Saint-Jalme, Michel & Hassanin, Alexandre, 2020, First insights into past biodiversity of giraffes based on mitochondrial sequences from museum specimens, pp. 1-33 in European Journal of Taxonomy 703 on page 24, DOI: 10.5852/ejt.2020.703, http://zenodo.org/record/398966
Giraffa camelopardalis subsp. reticulata de Winton 1899
No full textGiraffa camelopardalis reticulata de Winton, 1899 Giraffa camelopardalis australis Rhoads, 1896: 518. Giraffa hagenbecki Knottnerus-Meyer, 1910: 800. Giraffa reticulata nigrescens Lydekker, 1911: 484. Diagnosis Deep liver-red colour with a coarse network of narrow white lines, one ES in the Cytb gene: 795 C=>T; one ES in the CR: 94 C=>T. Type material Holotype KENYA • 1 specimen (skull, scalp and piece of neck skin); East of Loroghi mountains; NHMUK-1897.1.30.1. Distribution Southern Ethiopia, Kenya (holotype), Somalia.Published as part of Petzold, Alice, Magnant, Anne-Sophie, Edderai, David, Chardonnet, Bertrand, Rigoulet, Jacques, Saint-Jalme, Michel & Hassanin, Alexandre, 2020, First insights into past biodiversity of giraffes based on mitochondrial sequences from museum specimens, pp. 1-33 in European Journal of Taxonomy 703 on page 23, DOI: 10.5852/ejt.2020.703, http://zenodo.org/record/398966
Giraffa camelopardalis subsp. rothschildi Lydekker 1903
No full textGiraffa camelopardalis rothschildi Lydekker, 1903 Diagnosis Lower parts of the legs pure white and unspotted, spots show a tendency to split up into stars, occipital pair of ossicones, one ES in the CR: 129 T=> C. Type material Holotype KENYA • 1 specimen (mounted skin); Guasin-gisha Plateau east of Mount Elgon; NHMUK-1903.4.15.1. Distribution Western Ethiopia, Kenya (holotype), Uganda, South Sudan.Published as part of Petzold, Alice, Magnant, Anne-Sophie, Edderai, David, Chardonnet, Bertrand, Rigoulet, Jacques, Saint-Jalme, Michel & Hassanin, Alexandre, 2020, First insights into past biodiversity of giraffes based on mitochondrial sequences from museum specimens, pp. 1-33 in European Journal of Taxonomy 703 on page 23, DOI: 10.5852/ejt.2020.703, http://zenodo.org/record/398966
Giraffa tippelskirchi Matschie 1898
No full textGiraffa tippelskirchi Matschie, 1898 Diagnosis Faint or strongly stellate form of the patches, absence of occipital horns, seven ES in the UBN2 intron: 48 dA, 209 iCATAATATATTTAATATATTTAATATTTAATAA, 243 T=>A, 318 G =>C, 332 T=>G, 504 A=> C, 623 C=>T Type material Lectotype (here designated) TANZANIA • 1 specimen (skull and skin); Lake Eyasi; ZMB-084951. Distribution Kenya, Tanzania (lectotype), Zambia. Remarks Matschie (1898) mentions two different specimens as syntypes, but the second cannot be found in the collection catalogue and might be considered as lost.Published as part of Petzold, Alice, Magnant, Anne-Sophie, Edderai, David, Chardonnet, Bertrand, Rigoulet, Jacques, Saint-Jalme, Michel & Hassanin, Alexandre, 2020, First insights into past biodiversity of giraffes based on mitochondrial sequences from museum specimens, pp. 1-33 in European Journal of Taxonomy 703 on page 24, DOI: 10.5852/ejt.2020.703, http://zenodo.org/record/398966
- …
