8,020 research outputs found

    lin-31, a Caenorhabditis elegans HNF-3/fork head transcription factor homolog, specifies three alternative cell fates in vulva development

    No full text
    Late events in the cell-cell signalling pathway that controls the specification of vulva cell fates in C. elegans are characterized. The lin-31 gene acts downstream of the ras homolog let-60 and encodes a member of the HNF-3/fork head family of DNA-binding transcription factors. lin-31 regulates how vulval precursor cells choose their fate and in lin-31 mutants, these cells do not properly choose which fate to express and therefore adopt any of the 3 possible vulval cell fates in a deregulated manner..RE: 68 ref.; SC: CA; PE; 0TSource type: Electronic(1) http://upei-resolver.asin-risa.ca?sid=SP:CABI&id=pmid:&id=&issn=0890-9369&isbn=&volume=7&issue=6&spage=933&pages=933-947&date=1993&title=Genes%20and%20Development&atitle=lin-31%2c%20a%20Caenorhabditis%20elegans%20HNF-3%2ffork%20head%20transcription%20factor%20homolog%2c%20specifies%20three%20alternative%20cell%20fates%20in%20vulva%20development.&aulast=Miller&pid=%3Cauthor%3EMiller%2c%20L%20M%3bGallegos%2c%20M%20E%3bMorisseau%2c%20B%20A%3bKim%2c%20S%20K%3C%2Fauthor%3E%3CAN%3E19932337278%3C%2FAN%3E%3CDT%3EJournal%20article%3C%2FDT%3

    Liphistius liz Lin & Li 2023, sp. nov.

    No full text
    <p>Liphistius liz Lin & Li, 2023 sp. nov.</p> <p>Materials</p> <p> <b>Type status:</b> Holotype. <b>Occurrence:</b> catalogNumber: IZCAS-Ar44748; recordedBy: Yicheng Lin; individualCount: 1; sex: male; lifeStage: adult; occurrenceID: 5BCC41FF-4DC2-53C5-836F-F9BBC80D4BDE; <b>Taxon:</b> scientificName: Liphistius liz; <b>Location:</b> country: China; stateProvince: Yunnan; county: Lianghe; locality: Jiubao Achang Township, Shizunao; verbatimElevation: 1200 m; decimalLatitude: 24.7478; decimalLongitude: 98.2106; <b>Identification:</b> identifiedBy: Yejie Lin; dateIdentified: 2023; <b>Event:</b> year: 2023; month: 5; day: 13 <b>Type status:</b> Paratype. <b>Occurrence:</b> catalogNumber: IZCAS-Ar44749; recordedBy: Yicheng Lin; individualCount: 1; sex: female; lifeStage: adult; occurrenceID: 2177DB32-CFCD-5FED-9AAF-D1629797C869; <b>Taxon:</b> scientificName: Liphistius liz; <b>Location:</b> country: China; stateProvince: Yunnan; county: Lianghe; locality: Jiubao Achang Township, Shizunao; verbatimElevation: 1200 m; decimalLatitude: 24.7478; decimalLongitude: 98.2106; <b>Identification:</b> identifiedBy: Yejie Lin; dateIdentified: 2023; <b>Event:</b> year: 2023; month: 8; day: 12 <b>Type status:</b> Paratype. <b>Occurrence:</b> catalogNumber: IZCAS-Ar44750; recordedBy: Yicheng Lin; individualCount: 1; sex: female; lifeStage: adult; occurrenceID: 4FEE7ED6-6BCF-50BB-A7A5-D3C318237341; <b>Taxon:</b> scientificName: Liphistius liz; <b>Location:</b> country: China; stateProvince: Yunnan; county: Lianghe; locality: Jiubao Achang Township, Shizunao; verbatimElevation: 1200 m; decimalLatitude: 24.7478; decimalLongitude: 98.2106; <b>Identification:</b> identifiedBy: Yejie Lin; dateIdentified: 2023; <b>Event:</b> year: 2023; month: 8; day: 12 <b>Type status:</b> Paratype. <b>Occurrence:</b> catalogNumber: IZCAS-Ar44751; recordedBy: Yicheng Lin; individualCount: 1; sex: female; lifeStage: adult; occurrenceID: 34FCBAD1-1985-59EA-8784-A3605859BC42; <b>Taxon:</b> scientificName: Liphistius liz; <b>Location:</b> country: China; stateProvince: Yunnan; county: Lianghe; locality: Jiubao Achang Township, Shizunao; verbatimElevation: 1200 m; decimalLatitude: 24.7478; decimalLongitude: 98.2106; <b>Identification:</b> identifiedBy: Yejie Lin; dateIdentified: 2023; <b>Event:</b> year: 2023; month: 8; day: 12 <b>Type status:</b> Paratype. <b>Occurrence:</b> catalogNumber: IZCAS-Ar44752; recordedBy: Yicheng Lin; individualCount: 1; sex: female; lifeStage: adult; occurrenceID: BB3338CB-0A61-516F-BEA2-1CA2A06BA8E9; <b>Taxon:</b> scientificName: Liphistius liz; <b>Location:</b> country: China; stateProvince: Yunnan; county: Lianghe; locality: Jiubao Achang Township, Shizunao; verbatimElevation: 1200 m; decimalLatitude: 24.7478; decimalLongitude: 98.2106; <b>Identification:</b> identifiedBy: Yejie Lin; dateIdentified: 2023; <b>Event:</b> year: 2023; month: 8; day: 12</p> <p>Description</p> <p>Male (holotype, Figs 2, 3 b, 4, 7 A). Total length 7.55. Carapace 4.19 long and 3.83 wide, earthy yellow in ethanol (slightly lighter than in life), margin and fovea colour darker, without obvious dark stripes between coxal elevations (Fig. 7 A). Eye sizes and interdistances: AME 0.06, ALE 0.49, PME 0.25, PLE 0.35, AME-AME 0.08, AME-ALE 0.08, PME-PME 0.04, PME-PLE 0.06, AME-PME 0.02, ALE-PLE 0.05. Chelicerae reduced, brown, with several short macrosetae. Labium 0.73 long and 0.44 wide, fused with sternum. Sternum 1.98 long and 0.75 wide, posterior tip elongated. Opisthosoma 3.54 long and 2.29 wide, with ten tergites. Leg measurements: leg I 11.86 (3.26, 3.85, 3.17, 1.58), leg II 13.46 (3.83, 4.07, 3.51, 2.05), leg III 14.88 (3.53, 4.30, 4.47, 2.58), leg IV 19.41 (4.69, 5.51, 5.91, 3.30).</p> <p>Palp (Figs 2, 3 b, 4). Tibial apophysis of palp almost as high as wide, situated near retrolateral margin of tibia, with four megaspines. Cymbium with two clavate trichobothria retrolaterally (Fig. 4 D). Paracymbium large and thick, almost as wide as cymbium, cumulus distinctly elevated with many long setae (Fig. 4). Subtegulum curved in prolaterodorsal and ventral views, without obvious apophysis. Tegulum with a well-developed and denticulate distal edge. Half of the contrategulum strongly sclerotised, with a ventral process (Figs 2, 3 b). Paraembolic plate slightly elevated. Embolus partly sclerotised, with some longitudinal ridges extending to the tip, margins of these ridges slightly dentated (Figs 2, 3 b).</p> <p>Female (paratype, Figs 1, 5, 7 B). Total length 10.32. Carapace 4.87 long, 4.16 wide, colour as in males, except shades being darker (Figs 1, 7 B). Eye sizes and interdistances: AME 0.06, ALE 0.45, PME 0.27, PLE 0.31, AME-AME 0.06, AME-ALE 0.07, PME-PME 0.04, PME-PLE 0.05, AME-PME 0.04, ALE-PLE 0.05. Chelicerae robust, reddish-brown, with a few short stripes on dorsal side and several long macrosetae on retrolateral edge of fang groove. Labium 1.03 long, 0.52 wide. Sternum 242 long, 1.23 wide. Opisthosoma 5.92 long, 4.52 wide, with ten tergites. Leg measurements: leg I 8.60 (3.04, 2.77, 1.75, 1.04), leg II 8.63 (2.68, 3.16, 1.65, 1.14), leg III 9.80 (2.98, 3.14, 2.28, 1.48), leg IV 14.34 (3.93, 4.47, 3.83, 2.11).</p> <p>Vulva (Fig. 5): Poreplate with four notobvious protuberances (two anterolateral and two posterolateral), two posterolateral protuberances not attached to ventral rim of poreplate. Central dorsal opening globular, receptacular cluster grape-shaped. Bulging margins on ventral poreplate only extending to the posterolateral corner of poreplate (Fig. 5 B) and distance between bulging margins almost as wide as poreplate. Genital atrium straight. Posterior area of posterior stalk located in the same plane of poreplate and almost as wide as poreplate (Fig. 5 A).</p> <p>Diagnosis</p> <p> Males of the new species resemble <i>Liphistius nabang</i> Yu, Zhang & Zhang, 2021 by the general shape of the embolus and tegulum with a clearly outlined distal edge (Fig. 3) and similar body colouration (Fig. 7) and the female with a similar-shaped poreplate plate. However, <i>L. liz</i> sp. nov. can be distinguished by the male with curved subtegulum (Fig. 2) [vs. subtegulum straight in <i>L. nabang</i> (see Yu et al. (2021), figs. 3A and B)] and tibial apophysis almost as high as wide (Fig. 4) [vs. wider than high in <i>L. nabang</i> (see Yu et al. (2021), figs. 3 D-F)]. Females of the new species can be distinguished from those of <i>L. nabang</i> by the straight genital atrium (Figs 5, 6) [vs. genital atrium curved in <i>L. nabang</i> (see Yu et al. (2021), fig. 4)], posterior stalk and poreplate are located in the same plane (Figs 5, 6) [vs. posterior stalk perpendicular to poreplate in <i>L. nabang</i> (see Yu et al. (2021), fig. 4)] and posterior stalk two times longer than wide [vs. posterior stalk four times longer than wide in <i>L. nabang</i> (see Yu et al. (2021), fig. 4)].</p> <p>Etymology</p> <p>The specific name refers to the short name for the Laboratory of Invertebrate Zoology (LIZ), Institute of Zoology, Chinese Academy of Sciences in Beijing; noun in apposition. LIZ was founded by Shen Jia-Rui (see Dai (1997)) in 1928, later led by Daxiang Song (see Marusik (2008)) from 1975 to 1995 and has been led by the senior author Shuqiang Li from 1995 to the present.</p> <p>Distribution</p> <p>China (Yunnan; Fig. 8).</p> <p>DNA barcode</p> <p>CTGCGATGGTTATATTCAACAAATCACAAAGATATTGGAACTATATATTTAATTTTTGGTGTATGATCTGCCATAATCGGAACTGCACTAAGATTATTAATTCGAGCAGAATTAGGTCAACCAGGAAGATTAATCGGAGACGATCAAACATATAATGTAATTGTAACAGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCTATAATAATTGGAGGTTTTGGAAATTGATTAATCCCTCTTATACTAAGAGCCCCTGATATAGCTTTTCCTCGATTAAATAATTTAAGATTTTGATTATTACCCCCCTCTATCACCCTCTTATTGATTTCATCCATAGTAGAAAGAGGCTCCGGCACAGGTTGGACTATTTATCCCCCTATTGCTAGCATAGAATTTCACCCTGGTATATCTATTGATTATACTATTTTTTCATTACACCTTGCCGGGGCCTCTTCAATCTTAGGCGCAATTAATTTTATTACCACTATTATTAACATACGACCAAGAGGTATATTAATAGAGCGAGTACCATTATTTGTTTGATCTATTCTTATTACCGCAAGCCTACTGTTACTATCTTTACCTGTATTAGCTGGTGCGATTACTATGCTATTAACAGATCGAAATTTTAACACGTCATTTTTTGATCCAGCAGGAGGTGGTGACCCTATCCTATTCCAACATTTATTTTGATTTTTTGGTCATCCAGAAGTTTACATTCTTATTATTCCAGGTTTTGGGATAATTTCACATATTGTAAGACACAACGCTGGAAAAAAAGAACCTTTTGGGTCTTTAGGCATAATTTATGCAATATCCGCTATTGGATTACTAGGGTTTGTAGTCTGAGCACACCATATATTTACAGTAGGTATAGATGTTGATACACGAGCTTATTTCACAGCAGCAACCATAATTATTGCAATCCCCACAGGAATTAAAATTTTTAGATGATTAGCTACTCTTCATGGTACTAATTTAATCATAAGTACTTCCCTAATATGGTCTATTGGATTTATCTTCCTATTCACTATTGGTGGATTAACAGGCGTAATCCTAGCTAATTCATCTATTGATATTGTTCTTCATGATACATACTATGTAGTAGCTCATTTTCATTATGTTTTATCAATAGGAGCAGTTTTTGCAATTATAGCAAGAATTATTCACTGATTCCCTTTATTTTTTGGATTTTCATTTAATCAAACTTTATTAAAAATTAACTTTTTTTCCATATTTATTGGTGTAAATATAACCTTTTTCCCACAACACTTCTTAGGATTAAATGGAATACCACGACGATATTCAGATTACCCTGATATATTTATATCATGAAATGTAATTTCATCTTTAGGAAGAATTTTATCTTTTCTAGCAGTAATTATATTTATTTTAATTGTATGAGAAAGAATTATATCGAACCGTAATATTTATATTCCTACTCAATCACCTTCTTCAGTTGAATGAACTCAAAATATTCCTCCTTCTAATCATACCTTTAATCAACTCAATATACTCATTTTCTAA (GenBank accession number OR721885).</p> <p>Compared material examined</p> <p> <i>Liphistius nabang</i>: Holotype: ♂ (MHBU-ARA-00020000), CHINA, Yunnan Province, Dehong Dai and Jingpo Autonomous Prefecture, Yingjiang County, Nabang Town, 24.7521°N, 97.563°E, 265 m elev., 2 August 2019, leg. Quanyu Ji.</p> <p>Variation</p> <p>Vulvae of two paratype females, see Fig. 6.</p>Published as part of <i>Lin, Yejie & Li, Shuqiang, 2023, A new species of Liphistius Schiodte, 1849 (Araneae, Liphistiidae) from Yunnan, China, pp. 113290 in Biodiversity Data Journal 11</i> on page 113290, DOI: 10.3897/BDJ.11.e11329

    Meotipa luoqiae Lin & Li 2021, sp. nov.

    No full text
    Meotipa luoqiae Lin & Li, sp. nov. (Figs 47A–C, 48A–B, 53G–H) Diagnosis. The new species is similar to M. spiniventris (O. Pickard-Cambridge, 1869) but can be distinguished by the presence of 2 distal spines on the opisthosoma (vs. 4 distal spines in M. spiniventris), 2 conductor apophysis, and the straight Sp in ventral view (vs. curved in M. spiniventris). Description. Male (holotype, IZCAS-Ar42467, Figs 47A–C, 48A–B, 53G–H). Total length 2.65. Prosoma 0.93 long, 0.83 wide, pale yellow, flat. Sternum 0.50 long, 0.50 wide, pale yellow. Opisthosoma 0.93 long, 0.83 wide, pale yellow, with large white and tiny dark spots; with 2 strong spines on distal part. Eyes developed: AME 0.09, ALE 0.08, PME 0.09, PLE 0.08, AME–AME 0.09, AME–ALE 0.06, PME–PME 0.09, PME–PLE 0.06. Clypeus height about 3.33 times AME diameter. Chelicerae with 1 promarginal tooth, retromarginal tooth absent. Leg I femur 2.65, patella 0.45, tibia 2.15, metatarsus 2.75, tarsus 0.85. Patella and tibia II–IV: 1.60, 0.85, 1.75. Leg I pale yellow, femur with a disto-ventral spine; patella with a distodorsal spine; tibia with 2 dorsal spines. Legs II–IV same as leg I in spination. Palp (Figs 47A–C, 48A–B) patella with a strong spine; tibia with a strong retrolateral spine; Sp linear in ventral view; C coiled at end, with 3 small outgrowths; E with 2 apophyses at middle. Female. Unknown. Material examined. Holotype ♂, China: Yunnan, Menglun Nature Reserve (21.9589°N, 101.2050°E; elev. ca. 816 m), 4 August 2007, leg. Guo Zheng (IZCAS-Ar42467). Paratype. 1♂ (IZCAS-Ar42468), same data as holotype. Distribution. Only known from type locality. Etymology. The species name is honoring the Chinese rock singer Mrs. Qi Luo, which encouraged the author by her courage, freedom and spirit of exploration; noun (name) in apposition. Variation. Male (paratype). Total length 2.05–2.65; prosoma 0.88–0.93 long, 0.73–0.83 wide; sternum 0.50–0.55 long, 0.44–0.50 wide; opisthosoma 0.93–1.13 long, 0.63–0.83 wide.Published as part of Lin, Yejie, Marusik, Yuri M., Gao, Caixia, Xu, Hao, Zhang, Xiaoqing, Wang, Ziyi, Zhu, Wenhui & Li, Shuqiang, 2021, Twenty-three new spider species (Arachnida: Araneae) from Asia, pp. 91-152 in Zoological Systematics 46 (2) on page 146, DOI: 10.11865/zs.2021201, http://zenodo.org/record/536706

    Mimela ruyuanensis , Lin 1990

    No full text
    <i>Mimela ruyuanensis</i> Lin, 1990 <p>(Figs. 15A–E)</p> <p> <i>Mimela ruyuanensis</i> Lin, 1990: 24, fig. 11 [original description, type locality: Guangdong, Ruyuan]; Lin 1993: 57, fig. 42 (in text), pl. VII, fig. 55 & 56, pl. XV, fig. 41, pl. XXI, fig. 33 [redescription, <i>sericicollis</i> -group]; Zorn 2006: 269 [catalogued]; Krajčik 2007: 88 [catalogued]; Zorn & Bezděk 2016: 347 [catalogued].</p> <p> <b>Type material examined.</b> None. Type material was not located in SYSU (visited by the author, Dec. 2019). The identification is based on the original description and Lin (1993).</p> <p> <b>Additional material examined</b> (2♂♂, 1♀). 1♂ (CCPC), CHINA, Guangxi Province, Guilin City, Xing’an County, Gaozhai, 500~ 600m, V.21–23.2013, Yu-Feng Hsu leg.; 1♂, 1♀ (ZMPC), Guangxi, Xing’an County, Mount Maoershan 25~ 30-v-2011.</p> <p> <b>Remarks.</b> When describing <i>Mimela ruyuanensis</i>, Lin (1990) overlooked the closest sibling, <i>Mimela fruhstorferi</i> Ohaus, 1902 (Fig. 15F–K) from Mount Mauson, Vietnam. A male topotype of <i>M. fruhstorferi</i> examined by Carsten Zorn (personal communication 2019) confirms that they are allied but not conspecific as they possess different body color and shape of parameres. Males of <i>M. ruyuanensis</i> have purplish luster upon the reddish brown body, while females of both species are reddish brown (Lin 1990, 1993; Ohaus 1902). <i>Mimlea ruyuanensis</i> is recorded from Guangxi Province for the first time.</p> <p> <b>Distribution.</b> China: Guangdong, Guangxi *.</p>Published as part of <i>Zhao, Ming-Zhi, 2021, On the genus Mimela Kirby, 1823 (Coleoptera: Scarabaeidae: Rutelinae) from China and adjacent countries, with description of five new species, pp. 201-230 in Zootaxa 4995 (2)</i> on page 223, DOI: 10.11646/zootaxa.4995.2.1, <a href="http://zenodo.org/record/5056160">http://zenodo.org/record/5056160</a&gt

    Fertility defects in <i>lin-35</i> mutants are not maternal effect and are not strongly rescued by mating under moderate temperature stress.

    No full text
    (A) Mean brood size of fertile worms for each treatment. Presence or absence of maternally loaded lin-35(+)/LIN-35(+) indicated by M+/M- respectively; presence or absence of zygotically expressed lin-35(+) indicated by Z+/Z- respectively. Maternal load of lin-35(+) was not sufficient for fertility to be maintained in lin-35 M+Z- mutants at 26°C and zygotic expression of lin-35 in M-Z+ mutants rescued fertility loss in mutants at 26°C. M-Z- animals did not inherit any wild-type lin-35 products (protein or RNA) from their mother and did not have a wild-type copy of the lin-35 gene, M+Z- animals inherited lin-35 products from their mother but did not have a wild-type copy of the lin-35 gene, and M-Z+ did not inherit any wild-type lin-35 products (protein or RNA) from their mother but did have a wild-type copy of the lin-35 gene. * significantly different than wild type at the same temperature. P-value ≤ 0.05 using one-way ANOVA with Turkey correction. Error bars indicate ± SEM. (B) Mean brood size of fertile worms for each genotype under the different mating and growth conditions (continual growth of hermaphrodites at 20°C (blue) and continual growth at 26°C (red)). Mating with wild-type males did not significantly increase the brood size of lin-35 mutants expressing either somatic transgene at high temperature. * significantly different from same strain unmated at the same temperature. P-value ≤ 0.05 using students t-test. Error bars indicate ± SEM. For mated experiments, males were always grown to adulthood at 20°C and then mating occurred at the temperature of the hermaphrodite treatment.</p

    Vascular endothelial growth factor restores delayed tumor progression in tumors depleted of macrophages

    No full text
    Genetic depletion of macrophages in Polyoma Middle T oncoprotein (PyMT)-induced mammary tumors in mice delayed the angiogenic switch and the progression to malignancy. To determine whether vascular endothelial growth factor A (VEGF-A) produced by tumor-associated macrophages regulated the onset of the angiogenic switch, a genetic approach was used to restore expression of VEGF-A into tumors at the benign stages. This stimulated formation of a high-density vessel network and in macrophage-depleted mice, was followed by accelerated tumor progression. The expression of VEGF-A led to a massive infiltration into the tumor of leukocytes that were mostly macrophages. This study suggests that macrophage-produced VEGF regulates malignant progression through stimulating tumor angiogenesis, leukocytic infiltration and tumor cell invasion

    [[alternative]]Application of critical concepts, anaerobic power and energy expenditure in predicting rowing performance

    No full text
    [[abstract]]Application of critical concepts, anaerobic power and energy expenditure in predicting rowing performance June,2005 Hsin-Fu Lin Advisor: Jung-Charng Lin, Abstract Critical velocity (CV) and critical power (CP) have been proposed to be effective indirect anaerobic threshold methods in monitoring training and predicting performance of rowing respectively. The purpose of this study was to compare these two indexes in predicting indoor rowing performance by combining different physiological variables, including maximal oxygen uptake ( VO2max ), anaerobic threshold (AT4) and modified Wingate test, which are important physiological variables in endurance performance. In addition, whether or not the physiological variables (VO2, VCO2, VE, HR, [La-]) under these two critical intensities were stable was also examined. Fifteen elite female rowers (age 20.73± 1.44 years, height 1.64 ±0.35m, weight 56.64±4.38kg) were recruited in this study. VO2max (2.47 ±0.47L) and AT4(157.81 ±22.08W) were measured during a discontinuous graded exercise test, starting at 100W, on a Concept II ergometer increased by 25 W for each 3-min stage. Four test times of duration 90s, 240s, 600s, and 1200s were used to determine CP (139.49 ±20.37W), whereas CV( 4.00 ±0.14m/s) was estimated by 400m, 600m, 800m, 1000m maximal exertion trials in different days as well by using Linear distance-time model. Peak power (353.48 ±27.71W), maximum power (350.12 ±26.72W), minimum power (336.85 ±21.58W), mean power (314.44 ±27.87W), fatigue index (max power - min power/ mean power) were obtained using a modified Wingate test protocol (30s sprint) on the ergometer. Physiological variation of intensity at CV and CP, including VO2, VCO2, VE, HR, [La-], were measured every 5 minutes in 20-min constant rowing tests. The results of study showed that VO2max, AT4, CP, CV, peak power, mean power were significantly correlated with 2000 indoor rowing performance (r=?0.84, ?0.85, ?0.81, ?0.97, ?0.66, ?0.67, P<0.01). By submitting mean power, fatigue index, VO2max, AT4 with each index to a stepwise regression analysis, it produced two individual critical concept models as following to predict 2000 indoor rowing performance: CV model: T2000= ?131.83 CV(m/s)?1.00 fatugue index(%) +1023.91 (R2=0.96, SEE=4.10, p<.05); CP model: T2000=?22.59 VO2max(L/min)?.38AT4(W)+608.58 (R2 =0.82, SEE=8.05, p<.05). When rowing at CV on indoor ergometer (14±4 min), VO2, VE, HR, [La-] didn’t reach steady state and VCO2 was not different at different time points. Under CP, VO2, VCO2 didn’t change with time, however, there were significant difference of VE, HR, [La-] at different time points. Our findings in this study indicated that CV has more predictive power, representing as anaerobic threshold, than AT4 to predict rowing performance. Besides CV, fatigue index from modified Wingate test is also an important determinant for 2000-m performance of female rowers. Therefore, comparing with CP, CV could be used when applying critical concept in training and evaluate indoor performance in rowing. In addition, both two-parameter-derived CV and CP in rowing do not represent sustainable steady state intensities. Key words: critical velocity, critical power, anaerobic power, energy expenditure, rowing, performance.

    Process engineering developments in wine production Alternative technologies for tartrate stabilisation

    No full text
    Christopher B. Colby, Lin Lin Low, Jim Godden, Mark Gishen, Brian K. O'Neil

    C. elegans class A synMuv genes inhibit ectopic RAS-mediated vulval development by tightly restricting expression of lin-3 EGF

    No full text
    Thesis (Ph. D.)--Massachusetts Institute of Technology, Dept. of Biology, 2011.This electronic version was submitted by the student author. The certified thesis is available in the Institute Archives and Special Collections.Cataloged from student-submitted PDF version of thesis.Includes bibliographical references (p. 236-259).The class A and B synthetic multivulva (synMuv) genes of C. elegans redundantly antagonize an EGF/Ras pathway to prevent ectopic vulval induction. The class B synMuv genes encode many proteins known to remodel chromatin and repress transcription. The class A synMuv genes likely also function in transcription, although their specific molecular functions are unknown. We have identified a class A synMuv mutation in the promoter of lin-3 EGF, revealing that lin-3 is the key biological target of the class A synMuv genes in vulval development. Using FISH with single mRNA molecule resolution, we found that class AB synMuv double mutants exhibit widespread ectopic lin-3 expression. Our results show that lin-3 EGF is normally expressed in the germline, and many class B synMuv genes have previously been implicated in inhibiting germline fates in somatic cells. We propose that the class A synMuv genes specifically repress ectopic lin-3 EGF expression through a site in the lin-3 promoter and the class B synMuv genes either directly or indirectly repress lin-3 as a consequence of their role in regulating the germline/soma distinction. The class A and B synMuv genes had previously been thought of as two parallel pathways, but we have found that each of those pathways is actually composed of multiple parallel pathways. While class AB synMuv double mutants have a strong Muv phenotype, most class AA synMuv double mutants exhibit a weak Muv phenotype, and most pairs of class B synMuv mutants can enhance each other in sensitized backgrounds, indicating that most genes within a class can function in parallel. We also found that some pairs of synMuv genes cannot act in parallel, indicating that they function together to repress ectopic lin-3 expression. We also report the molecular characterization of the class A synMuv gene lin-38 and the identification of mcd-1 as a class A synMuv gene. lin-38 and mcd-1 encode paralogous zinc-finger proteins. Unlike previously studied class A synMuv genes that function specifically in vulval development by repressing lin-3, both lin-38 and mcd-1 control multiple aspects of development by regulating target genes other than lin-3.by Adam M. Saffer.Ph.D

    Give growth and macroeconomic stability in Russia a chance - harden budgets by eliminating nonpayments

    No full text
    The authors analyze the links between Russia's disappointing growth performance in the second half of the 1990s, its costly and unsuccessful stabilization, the macroeconomic meltdown of 1998, and the spectacular rise of non-payments. Non-payments flourished in an environment of fundamental inconsistency between a macroeconomic policy geared at sharp disinflation, and a microeconomic policy of bailing enterprises out through soft budget constraints. Heavy untargeted implicit subsidies flowing through the non-payments system (amounting to 10 percent of GDP annually) have stifled growth, contributed to the August 1998 meltdown, through their impact on public debt, and have made at best a questionable contribution to equity. Dismantling this system must be a top priority, along with promoting enterprise restructuring and growth (by hardening budget constraints) and medium-term macroeconomic stability (by reducing the size of subsidies). Getting the government out of the non-payments system means settling all appropriately controlled budgetary expenditures on time, and in cash, and eschewing spending arrears, thereby setting an example for enterprises, and laying the groundwork for eliminating tax offsets at all levels of government, and insisting on cash tax payments. To stop energy-related subsidies, would require not only that the government pay its own energy bills on time, and in cash, but also that the energy monopolies be empowered to disconnect non-paying clients. This will enable the government to insist that the energy monopolies in turn pay their own taxes in full, and on time.Banks&Banking Reform,Public Sector Economics&Finance,Economic Theory&Research,Payment Systems&Infrastructure,Environmental Economics&Policies,Banks&Banking Reform,Environmental Economics&Policies,Municipal Financial Management,Public Sector Economics&Finance,Economic Theory&Research
    corecore