45 research outputs found

    The Potential of Intrinsically Magnetic Mesenchymal Stem Cells for Tissue Engineering

    No full text
    The magnetization of mesenchymal stem cells (MSC) has the potential to aid tissue engineering approaches by allowing tracking, targeting, and local retention of cells at the site of tissue damage. Commonly used methods for magnetizing cells include optimizing uptake and retention of superparamagnetic iron oxide nanoparticles (SPIONs). These appear to have minimal detrimental effects on the use of MSC function as assessed by in vitro assays. The cellular content of magnetic nanoparticles (MNPs) will, however, decrease with cell proliferation and the longer-term effects on MSC function are not entirely clear. An alternative approach to magnetizing MSCs involves genetic modification by transfection with one or more genes derived from Magnetospirillum magneticum AMB-1, a magnetotactic bacterium that synthesizes single-magnetic domain crystals which are incorporated into magnetosomes. MSCs with either or mms6 and mmsF genes are followed by bio-assimilated synthesis of intracytoplasmic magnetic nanoparticles which can be imaged by magnetic resonance (MR) and which have no deleterious effects on MSC proliferation, migration, or differentiation. The stable transfection of magnetosome-associated genes in MSCs promotes assimilation of magnetic nanoparticle synthesis into mammalian cells with the potential to allow MR-based cell tracking and, through external or internal magnetic targeting approaches, enhanced site-specific retention of cells for tissue engineering

    Biosynthesis of magnetic nanoparticles by human mesenchymal stem cells following transfection with the magnetotactic bacterial gene mms6

    No full text
    The use of stem cells to support tissue repair is facilitated by loading of the therapeutic cells with magnetic nanoparticles (MNPs) enabling magnetic tracking and targeting. Current methods for magnetizing cells use artificial MNPs and have disadvantages of variable uptake, cellular cytotoxicity and loss of nanoparticles on cell division. Here we demonstrate a transgenic approach to magnetize human mesenchymal stem cells (MSCs). MSCs are genetically modified by transfection with the mms6 gene derived from Magnetospirillum magneticum AMB-1, a magnetotactic bacterium that synthesises single-magnetic domain crystals which are incorporated into magnetosomes. Following transfection of MSCs with the mms6 gene there is bio-assimilated synthesis of intracytoplasmic magnetic nanoparticles which can be imaged by MR and which have no deleterious effects on cell proliferation, migration or differentiation. The assimilation of magnetic nanoparticle synthesis into mammalian cells creates a real and compelling, cytocompatible, alternative to exogenous administration of MNPs.</p

    Protection Against Lipopolysacharide-Induced Myocardial Dysfunction in Mice by Cardiac-Specific Expression of Soluble Fas

    No full text
    The mechanisms responsible for myocardial dysfunction in the setting of sepsis remain undefined. Fas ligation with its cognate ligand (FasL) induces apoptosis and activates cellular inflammatory responses associated with tissue injury. We determined whether interruption of Fas/FasL interaction by cardiac-specific expression of soluble Fas (sFas), a competitive inhibitor of FasL, would improve myocardial dysfunction and inflammation in a lipopolysacharide (LPS)-induced mouse model of sepsis. Wild-type (WT) and sFas transgenic mice were injected intraperitoneally with 10 mg/kg LPS or with an equivalent volume of saline. At 18 h after LPS administration, echocardiographic evaluation revealed a significant decrease in left ventricular fractional shortening in the WT mice, whereas the fractional shortening was preserved in the sFas mice. Activation of nuclear factor-kappa B (NF-κB) and the increase in the transcript levels of proinflammatory cytokines, tumor necrosis factor (TNF)-α, interleukin (IL)-1β, and IL-6 resulting from LPS treatment were attenuated in the myocardium of sFas mice. sFas expression also inhibited LPS-induced upregulation of Toll-like receptor 4 (TLR-4) and inducible nitric oxide synthase (iNOS), and formation of peroxynitrite in the myocardium. LPS-induced increase in caspase-3/7 activity and apoptotic cell death were suppressed in sFas mice compared with WT mice. LPS-induced lung injury and increase in lung water content were also significantly reduced in sFas mice. These data indicate that neutralization of FasL by expression of sFas significantly preserves cardiac function and reduces inflammatory responses in the heart, suggesting that Fas/FasL signaling pathway is important in mediating the deleterious effects of LPS on myocardial function

    Functional Roles for CSPG4/NG2 in Chondrosarcoma

    No full text
    CSPG4/NG2 is a multifunctional transmembrane protein with limited distribution in adult tissues including articular cartilage. The purpose of the current study was to investigate possible roles for CSPG4/NG2 in chondrosarcomas and to establish whether this molecule may have potential for targeted therapy. Stable knock down of CSPG4/NG2 in the JJ012 chondrosarcoma cell line by shRNA resulted in decreased cell proliferation and migration as well as a decrease in gene expression of the MMP (matrix metalloproteinase) 3 protease and ADAMTS-4 aggrecanase. Chondrosarcoma cells in which CSPG4/NG2 was knocked down were more sensitive to doxorubicin than wild type cells. The results indicate that CSPG4/NG2 has roles in regulating chondrosarcoma cell function in relation to growth, spread and resistance to chemotherapy and that anti-CSPG4/NG2 therapies may have potential in the treatment of surgically irresectable chondrosarcoma

    Genomics of the human Y chromosome and molecular diagnosis

    No full text
    The human Y chromosome carries a few functional genes as against a plethora of non-coding DNA sequences and shows a high degree of geographical and ethnic variations for a range of loci manifested as genetic polymorphisms. Y-chromosome linked sequence tagged sites (STS) and short tandem repeat (STR) marker systems offer infallible tool for gender identification, paternity testing, genome individualization and assessing male fertility status. Population-specific Y haplotypes and Single Nucleotide Polymorphisms (SNPs) are envisaged to be useful in establishing a correlation between diseased phenotypes with genetic polymorphisms. We discuss genomics of the human Y-chromosome and its possible applications in biology, medical and forensic sciences

    Monocyte Chemoattractant Protein-1 Induces A Novel Transcription Factor That Causes Cardiac Myocyte Apoptosis And Ventricular Dysfunction

    No full text
    Monocyte chemoattractant protein-1 (MCP-1; CCL2)-mediated inflammation plays a critical role in the development of ischemic heart disease (IHD). However, the gene expression changes caused by signal transduction, triggered by MCP-1 binding to its receptor CCR2, and their possible role in the development of IHD are not understood. We present evidence that MCP-1 binding to CCR2 induces a novel transcription factor (MCP-induced protein [MCPIP]) that causes cell death. Gene microarray analysis showed that when expressed in hiuman embryonic kidney 293 cells, MCPIP induced apoptotic gene families before causing cell death. Mutagenesis studies showed that the structural features required for transcription factor-like activity were also required for causing cell death. Activation of caspase-3 was detected after MCPIP transfection and Z-VAD-fmk partially inhibited cell death. Cardiomyocyte-targeted expression of MCP-1 in mice caused death by heart failure at 6 months of age. MCPIP expression increased in parallel with the development of ventricular dysfunction. In situ hybridization showed the presence of MCPIP transcripts in the cardiomyocytes and immunohistochemistry showed that MCPIP was associated with the cardiomyocyte nuclei of apoptotic cardiomyocytes. CCR2 expression in cardiomyocytes increased with the development of IHD. MCPIP production induced by MCP-1 binding to CCR2 in the cardiomyocytes is probably involved in the development of IHD in this murine model. MCPIP transcript levels were much higher in the explanted human hearts with IHD than with nonischemic heart disease. These results provide a molecular insight into how chronic inflammation and exposure to MCP-1 contributes to heart failure and suggest that MCPIP could be a potential target for therapeutic intervention. © 2006 American Heart Association, Inc

    Genomics of the human Y chromosome and molecular diagnosis

    No full text
    The human Y chromosome carries a few functional genes as against a plethora of non-coding DNA sequences and shows a high degree of geographical and ethnic variations for a range of loci manifested as genetic polymorphisms. Y-chromosome linked sequence tagged sites (STS) and short tandem repeat (STR) marker systems offer infallible tool for gender identification, paternity testing, genome individualization and assessing male fertility status. Population-specific Y haplotypes and Single Nucleotide Polymorphisms (SNPs) are envisaged to be useful in establishing a correlation between diseased phenotypes with genetic polymorphisms. We discuss genomics of the human Y-chromosome and its possible applications in biology, medical and forensic sciences

    Random amplification of polymorphic DNA with conserved sequences reveals genome-specific monomorphic amplicons: implications in clad identification

    No full text
    The enzymatic amplification of genomic DNA with an arbitrary primer generates informative band profile useful for genome analysis. We used a set of synthetic oligodeoxyribonucleotide primers OAT15.2 (GACA)3.75, OAT18. 2 (GACA)4.5, OAT24.2 (GACA)6, OAT36 (GACA)9, comprising 4-9 consecutive units of GACA repeat, O33.15 (CACCTCTCCACCTGCC) and 033.6 (CCTCCAGCCCTCCTCCAGCCCT) for RAPD reactions of genomic DNA from different sources. The GACA based oligos of 15 and 18 base residues generated discernible genome specific amplicons whereas primers larger than 18 bases revealed smeary signals. The other oligos O33.15 and O33.6 also generated genome specific amplicons with more bands compared with those obtained from OAT15.2 or OAT18.2. The presence of OAT15.1 (GATA)3.75 and OAT15.2 (GACA)3.75 sequences in different genomes were ascertained by independent dot-blot hybridization prior to using them for RAPD reactions. The RAPD amplicons generated by evolutionarily conserved primer(s) or sequences shared by many species may be useful for clad identification in controversial systematics, comparative genome analysis, and for establishing the phylogenetic status of an organism
    corecore